/mdt/ - Contrôle Vé - 26

Contrôle Vé - 26 (396 Réponses)

1 .

https://youtu.be/DCGyLjBjuGI

Cette vidéo résonne à un instant ou il devient probable que notre couple devienne non-monogame.

2 .

>>1
C'était vraiment pas terrible. Du temps de visionnage authentiquement gaspillé.

3 .

>>2
Pas terrible oui. Mais pas inutile non plus. Ça touche à tout sans rien approfondir. Malgré tout intérressant selon moi.

4 .

https://www.youtube.com/watch?v=kpN9etQUpWk

5 .

https://www.youtube.com/watch?v=w6o4TaE9mJg

6 .

For example, the common one-dimensional portrayal of women as harmless victims reinforces outdated gender stereotypes. This keeps us from seeing women as complex human beings, able to wield power, even in misguided or violent ways. And, the assumption that men are always perpetrators and never victims reinforces unhealthy ideas about men and their supposed invincibility. These hyper-masculine ideals can reinforce aggressive male attitudes and, at the same time, callously stereotype male victims of sexual abuse as “failed men.”

Other gender stereotypes prevent effective responses, such as the trope that men are sexually insatiable. Aware of the popular misconception that, for men, all sex is welcome, male victims often feel too embarrassed to report sexual victimization. If they do report it, they are frequently met with a response that assumes no real harm was done.

7 .

http://shiba.over-blog.com/article-difference...

8 .

Just found out that not only do Asian men suffer from the highest incidence of 'Micropenis' worldwide, literally EVERY SINGLE ONE of them carries the mutated gene that is responsible for it.

This mutation occurs within an gene known as 'SRD5A2', an enzyme that is less active in Asian men and is responsible for processing the hormone testosterone to dihydrotestosterone (DHT), an androgen which is more 5x more potent than regular testosterone.(1)

Dihydrotestosterone (DHT) is a sex hormone created from testosterone in the body. It plays a major role in the development of characteristics that are typically associated with men (body hair, muscle growth, and a deep voice).
This less active enzyme in Asian men(2) is the reason they have lower DHT levels compared to other races of men,(3) it may also explain why their penises are smaller on average (unconfirmed) as DHT is necessary for the maturation of the penis.

The mutation is known as 'R227Q', and is a non synonymous change in the 'SRD5A2' gene.(4) 'R227Q' been shown to retain approximately 3.2% of normal enzyme activity and appears relatively frequent in Asian populations.(5)

It is time for Asian bois to renounce their masculinity, transition to womanhood, and live out the rest of their lives content as cock sleeves to physically superior men

sources https://www.news-medical.net/health/What-is-M... (1)
https://www.ncbi.nlm.nih.gov/pubmed/1827450 (2)
https://www.ncbi.nlm.nih.gov/pubmed/8672990 (3)
https://snpedia.com/index.php/Rs9332964 (4)
https://www.ncbi.nlm.nih.gov/pubmed/12843198 (5)

9 .

>>8
Le mec va quand même à l'encontre du premier article qu'il cite, c'est chaud/
Historically, Micropenis was treated by gender reassignment of the baby at birth. (6)
This meant that parents were advised to bring their genetically male children up as females. (11)
John Money, the founder of the Gender Identity Clinic at John Hopkins University Medical Centre in Baltimore, was an advocate of gender reassignment. (12, 13)
In 1975, he published a paper outlining the success of a gender reassignment study, in which a twin son had been successfully brought up as a girl. (11, 12)
Money’s study was, however, later discredited by Milton Diamond and later journalist Colapinto, who both showed that the gender re-assignment had not been a success. (12)
Specifically, the genetically male child who had been brought up as a female, decided to change back to her original gender when she found out the truth about her gender re-assignment. Moreover, in 2004, the patient took his own life. (12)

10 .

https://drive.google.com/drive/folders/1gAb3o...

11 .

Je vois pas pourquoi les gens s’offusque et crient au révisionnisme et à la propagande, c'est juste un jeu. D'ailleurs, historiquement, les femmes ont combattu pendant la guerre, c'est grâce aux femmes noires et aux homosexuel transgenre qu'on a gagné contre les nazis. Les gens sont juste stupide et ignorant, bref, des fachos...

12 .

his rebuttal feels less like a reasoned response and more like someone yelling “NO U” into Wordpress

13 .

https://www.letemps.ch/sciences/google-reve-c...

14 .

The soft error rate (cosmic rays, alpha decay, etc.) for modern memory
at sea level is estimated to be somewhere around 1000 - 5000
FIT/Mbit[1]. FIT is Failures in Time - errors per billion hours of
use. If you've got 1GB of memory, you've got 8000Mbits. So you'd
expect 8M - 40M errors per billion hours on your machine. Or 8 to 40
errors per 1000 hours. That's about one single-bit error per week to
one per day.

15 .

http://www.voyagoo.fr/japon/tokyo/l-histoire-...

16 .

conclusions de relaxe

17 .

Pour ceux qui ne me connaissent pas je m'appelle Chloé, j'ai 21 ans et je suis diplômée en Infographie. Je suis actuellement (septembre 2018) en train de faire une formation en tant que psycho-sexologue sur 3 ans afin d'ouvrir mon cabinet de sexologie et aider autrui à s'épanouir dans sa vie sexuelle 👩🏼‍🎓📚

Mes réseaux sociaux :
Snapchat 👻 xsouthghost
Instagram 📸 rarewhitegirlzzz

18 .

Ceci est une file d'attente automatique

19 .

>>17
Elle commence à se faire une petite célébrité cette fille.

20 .

Les appareils hospitaliers de tomodensitométrie et d'IRM étant généralement adaptés à des patients de moins de 150 kilogrammes, les personnes souffrant d'obésité sont parfois invitées à aller passer leur examen dans des zoos9.

21 .

>>15
😭😭😭😭😭

22 .

http://250bpm.com/blog:128

23 .

>>22
J'ai vu Eliezer Yudkowsky et j'ai faillit refermer aussi tôt, mais c'est un fait une revue d'un livre d'Ostrom, qui est connue en économie et en sociologie pour des articles/livres devenus des classiques.

24 .

https://www.youtube.com/watch?v=2m1PocLMAcc

25 .

http://archive.is/JkHuE

26 .

https://www.youtube.com/watch?v=jQ9Wh1pLQfw

27 .

pant depuis [x] années le poste de [indiquer] au sein du service [indiquer], je souhaite aujourd’hui évoluer dans ma carrière, au sein de notre société.

Le département [indiquer] étant à la recherche d’un nouveau [indiquer] pour étoffer ses équipes [commerciales/techniques/autre], je souhaiterais présenter ma candidature.

Titulaire d

28 .

http://www.lefigaro.fr/musique/2018/05/26/030...

29 .

https://pbs.twimg.com/profile_images/99862288...

30 .

kouni tamou7a

31 .

Gustave de Kerven

32 .

https://orig00.deviantart.net/8f98/f/2015/329...

33 .

http://www.leparisien.fr/faits-divers/cyberha...

34 .

https://www.youtube.com/watch?v=z8tI8Cw1SeE

35 .

J'hésite à en acheter quelques uns pour remplacer mes tote bags vieillissant de la Gaîté lyrique ou des Siestes Electroniques
https://www.leboncoin.fr/vi/1372051249.htm/

36 .

https://vocaroo.com/i/s1eVQGm0OJhN

37 .

https://twitter.com/DomiaFatima/status/991102...

38 .

>>37
dominatrice financière Ben putain.

39 .

>>38
L'un des seuls pans du sexe virtuel où l'offre est plus forte que la demande. Forcément.

40 .

>>39
Je comprends même pas que ça puisse vraiment exister, c'est littéralement une contradiction dans les termes. Si le dominé entretient financièrement le dominant sans contrainte alors c'est le dominant qui est dépendant.

41 .

>>40
La soumission sexuelle repose sur le choix conscient de l'individu qui se soumet. Toutes les formes de rapport dominant/soumis dans un cadre de jeu sexuel entre individus consentants présentent cet aspect ironique.
t. esclave sexuelle de sa copine

42 .

>>40
alors c'est le dominant qui est dépendant. Non pas du tout. Parfois la dominatrice financière a des revenus réguliers à côté, et ne se servira de l'argent du dominé que pour se faire des cadeaux (il me semble que c'est souvent le cas). Dans d'autres cas, la domina a plusieurs soumis qui lui permettent un niveau de vie confortable, mais elle n'est pas dépendante d'un soumis en particulier.

Et je ne suis pas d'accord avec >>41. Tous les rapports D/s n'ont pas forcément d'aspect "ironique".

43 .

>>42
À partir du moment où cela se fonde sur un consentement mutuel, le reste n'est que jeu.

44 .

https://www.youtube.com/watch?v=otNafgZdOUY

45 .

Male yurifags are much purer because we don't project our 3dpd selves into yuri.

46 .

https://www.youtube.com/watch?v=Xwdn4WBkfd4

47 .

+24ºC yesterday in eastern Iceland. 32ºC in Norway. +30ºC in Netherlands and Sweden and almost 34ºC in Germany !!! Meanwhile Lisbon didn't went above 20ºC, Porto didn't above 18ºC or Bilbao above 19ºC, it was 33ºC in Postdam, 29ºC in Copenhague and 30ºC in Wroclaw. Málaga didn't went above 26ºC or Heraklion above 25ºC!

48 .

https://docs.racket-lang.org/rash/index.html
Rien de plus satisfaisant que de voir ses idées implémentées sans avoir eu à lever le petit doigt.

49 .

>>48
Sentir bon homme.

50 .

En Algérie, on ne coupe pas la tête des homosexuels, l'homosexualité existe, d'ailleurs tous les chanteurs de Raï sont homosexuels

51 .

https://www.unicornriot.ninja/2018/bulletproo...

52 .

I love little cultural differences, like how Americans are super offended by the word cunt but here in Australia we're super offended by school children being slaughtered with automatic weapons

53 .

http://img42.xooimage.com/files/8/7/b/pelican...

54 .

https://www.youtube.com/watch?v=tUTu7ZOkhO0

55 .

I don't get it. What makes the relationship romantic if there's nothing sexual to it? Isn't sex ultimately why romantic relationships are a thing, you know, to get to know someone before you open up sexually to them? What makes romance without the sex any different than a close friendship? Why not simply call it friendship then?

(L'absolue tristesse de l'état d'esprit que traduisent ces questions.)

56 .

https://news.ycombinator.com/item?id=17217051

57 .

>>55
L'absolue absence d'argument derrière ton jugement. D'autant plus que des relations romantiques sans attraction sexuelles j'en ai jamais vu.

58 .

Ray's personal model of reality, called "Time Cube", states that all of modern physics and education is wrong,[4] and argues that, among many other things, Greenwich Time is a global conspiracy. He utilizes various graphs (along with pictures of himself) that purport to show how each day is really four separate days—sunup, midday, sundown, and midnight (formerly morning, early afternoon, late afternoon, and evening)—occurring simultaneously.

59 .

https://www.youtube.com/watch?v=O2mCW_swjaE

60 .

https://fr.m.wikipedia.org/wiki/Pale_Male

61 .

HN is exactly like women magazines, except for devs.

62 .

https://www.corsematin.com/article/societe/po...

63 .

Votre déclaration a bien été enregistrée le 04 juin 2018 à 23:59:28.

64 .

https://www.iza.org/publications/dp/11532/mat...

65 .

Yael Mellul is nothing short of a shyster and a crook. She swindled someone dear to me out of a cool 3,000 euros in the spring of 2014. She teamed up with a charlatan by the name of François Pineda, who charged my friend another 2,000 euros and did absolutely nothing. The latter was not even a lawyer (it is illegal in France for a lawyer to share their fees with someone who is not a registered attorney), some sort of consultant who preys on people who have experienced psychological drama. Needless to say, Mellul treated my friend with nothing but scorn when she informed her she would no longer need her services. She tried to avoid giving her her case file back, but eventually reluctantly agreed to do so. Of course, not once did she mention giving a dime of the 3,000 euros back, even if she had done some work on the case, which is highly doubtful. A hate-filled dishonest person. Avoid her like the plague.

66 .

Soso Madness

67 .

https://www.franceculture.fr/emissions/lsd-la...

68 .

https://www.youtube.com/watch?v=7hhVeRqfcjo

69 .

https://www.buzzfeed.com/krishrach/alexander-...

70 .

https://www.meetup.com/fr-FR/Paris-Elon-Musk-Fan-Club/

71 .

>>70
Mon malaise-o-mètre a tapé le rupteur plus vite que le compte-tours d'une Porsche Carrera au point mort.

72 .

https://twitter.com/mathieumatiu/status/10042...

73 .

https://www.youtube.com/watch?v=v7yHm4f5xRc&a...

74 .

https://www.youtube.com/watch?v=v3ERgu6fV9s&t=52s

75 .

https://www.arte.tv/fr/videos/066346-000-A/le...

76 .

https://www.youtube.com/watch?v=eQBASk5QEIA

77 .

(And yes, before you ask, work on WINDS OF WINTER continues, and remains my top priority. It is ridiculous to think otherwise. If I wasn’t busy with WINDS, don’t you think I’d be scripting one or more of these pilots myself? It’s not as if I’ve never written for TV… )

78 .

https://en.wikipedia.org/wiki/Al-Ma%CA%BFarri

79 .

>>78
Grosso modo Spinoza.

80 .

Et si docker était une mauvaise idée, en tout cas tel que c'est utilisé avec des images qu'on télécharge comme ça sans vraiment savoir ce qu'il y a dedans ? Pffff non n'importe quoi, t'es pas un dév 10x clairement, docker c'est webscale https://arstechnica.com/information-technolog...

81 .

https://www.youtube.com/watch?v=kxeLxGzoN_w

82 .

Trans women’s bodies are female bodies, whether or not we have penises.

83 .

https://www.youtube.com/watch?v=MVnSFj6XQZY

84 .

11172☣ CosmosHelios-

85 .

Salut, je recherche une colocataire,(une etudiante ou une femme âgée de moins de 27ans) pour un studio cosy et lumineux

86 .

//+34664124222

87 .

Smys3lf
Smys3lf
il y a 1 jour (modifié)
Je vous donne mes conseils pour louer une habitation à un particulier.

-Choisissez des habitations dans vos moyens (ça parait logique, mais bon, j'en ai vu beaucoup louer des trucs au dessus de leurs moyens)
-Préparer votre dossier, soyez prêt à mentir si il le faut.
Ça peut paraitre dégueulasse dit comme ça, mais bon, quand on vois 2 caravanes pourries louées à 600€, il n'est pas bon de nos jours de jouer les saints.
Certains vont me dire "oui mais ils demandent des fiches de paie" .... oui je sais et je répète ce que j'ai dit, soyez prêt à mentir ... le papier se laisse imprimer.
-Soigner votre apparence.
Alors là, c'est très con, mais il faut être honnête, ça joue énormément. Ça ne devrait avoir aucune importance, mais ne vous pointez pas à une visite fringué n'importe comment. Il faut jeter de la poudre aux yeux à la face des proprios.
Si un ami à vous à une chouette voiture, essayer de vous la faire prêter pour la visite... c'est débile, mais ça marche... testé et approuvé.
-N'ayez pas l'air désespéré.
Évidement c'est pas toujours évident, parce que beaucoup le sont. Néanmoins garder en tête que les proprios s'en foutent, pire, ça leurs fait peur. Remettez l’église au milieu du village, vous êtes le client, vous devez faire en sorte qu'ils ai besoin de vous, pas l'inverse.
-Le loyer en top priorité.
Il est claire que la vie n'est pas toujours simple. Il est facile de se retrouvé pris à la gorge. Cependant, à moins de perdre complétement ses revenus, je conseil de placer le loyer en priorité des paiements.
Il vaut mieux perdre sa voiture, ses meubles ou se faire couper l'électricité plutôt que ne pas payer son loyer.
De plus, poser en preuve, des années de loyer payé en temps et en heure est un atout de premier ordre.

Voilà, je vous ai donné les techniques qui m'ont déjà sorti des ennuis par le passé. Si d'autres en ont, n'hésitez pas à les donner.

88 .

https://www.revealnews.org/blog/immigrant-chi...

89 .

Just in case anybody wondered: The lyrics are about a girl walking through a post-apocalyptic landscape, telling how the world was destroyed. 99 balloons were mistaken for UFOs. 99 jet plains were sent to destroy them, which was mistaken as an airstrike by the neighbouring countries. This led to 99 years of war which left the world in ruins. The girl finds a balloon and lets it fly, thinking of a beloved person. Yup, that's what this cheerful song is all about. It's a metaphor for the Cold War and the impending nuclear war.

90 .

re contrôle. Cerman Group est dissoute et Pimura complètement dormante (…) Je ne répondrai

91 .

https://video-lhr3-1.xx.fbcdn.net/v/t42.9040-...

92 .

What counts as rape in Australia? Almost no women are "rapists" in the US, but ~40% of the perpetrators of non-consentual sex are women.

Scientific American - https://www.scientificamerican.com/article/se...

data revealed that over one year, men and women were equally likely to experience nonconsensual sex, and most male victims reported female perpetrators. Over their lifetime, 79 percent of men who were “made to penetrate” someone else (a form of rape, in the view of most researchers) reported female perpetrators. Likewise, most men who experienced sexual coercion and unwanted sexual contact had female perpetrators.

The Atlantic - https://www.theatlantic.com/science/archive/2...

a 2014 study of 284 men and boys in college and high school found that 43 percent reported being sexually coerced, with the majority of coercive incidents resulting in unwanted sexual intercourse. Of them, 95 percent reported only female perpetrators.

Time - http://time.com/3393442/cdc-rape-numbers

when asked about experiences in the last 12 months, men reported being “made to penetrate”—either by physical force or due to intoxication—at virtually the same rates as women reported rape (both 1.1 percent in 2010, and 1.7 and 1.6 respectively in 2011).

In other words, if being made to penetrate someone was counted as rape—and why shouldn’t it be?—then the headlines could have focused on a truly sensational CDC finding: that women rape men as often as men rape women.

93 .

https://dood.al/pinktrombone/

94 .

"GOOD DAY, SIR! I SAID : GOOD DAY, SIR!". "Good day, sir", Of course the "go fuck yourself" of 1876. What a splendid time in american history where you would just say a greeting in an angry tone and everybody knew you meant business.

95 .

https://www.nytimes.com/interactive/2017/01/1...

Ce serait sympa d'avoir un truc pareil pour nos politiques.

96 .

I'm using lots of neovim plugins for syntax highlighting etc. Some of the plugins rely on npm/node modules. Some rely on rubygems. Should I add these as dev dependencies in my projects ?

97 .

https://m.facebook.com/MuseumOfInternet/photo...

98 .

https://www.lci.fr/societe/comment-vous-defen...

99 .

https://twitter.com/LUDO_dsp/status/101028369...

100 .

https://vocaroo.com/i/s1CcTaDhgoky

101 .

http://muskorhitler.com/

102 .

gina fistamante

103 .

geom_point(size=2, pch=21, fill='white', stroke=0.75) +

104 .

https://m.facebook.com/MuseumOfInternet/photo...

105 .

Anon, est-ce que tu connaîtrais l'artiste pour la musique de cette démo https://youtu.be/26YxOt-L1kQ?t=149 ?

106 .

https://www.bellingcat.com/news/uk-and-europe...

107 .

https://splinternews.com/this-is-just-the-beg...

108 .

http://kcsrk.info/papers/pldi18-memory.pdf

109 .

https://www.instagram.com/mat.i/

110 .

>>108
Pas aussi bon que son papier sur MLsub.

111 .

https://www.ledevoir.com/monde/afrique/531084...

112 .

https://www.youtube.com/watch?v=3XQfuFr-yuw

113 .

http://www.adultswim.com/videos/infomercials/...

114 .

iam: ATTRIBUTION
op: IN
values: 'allAuthenticatedUsers'
}

115 .

"Musk accused of stealing farting unicorn".

J'ai vu ce titre sur le site de la BBC.

116 .

Le mec assis en face de moi a un symbole peace&love sur l'avant bras et une croix gammée sur le doigt

J'aimerais qu'on m'explique

117 .

Intelligence is highly heritable1 and a major determinant of human health and well-being2. Recent genome-wide meta-analyses have identified 24 genomic loci linked to variation in intelligence3,4,5,6,7, but much about its genetic underpinnings remains to be discovered. Here, we present a large-scale genetic association study of intelligence (n = 269,867), identifying 205 associated gen

118 .

>>117
Un papier « scientifique » qui parle des mesures de quelque chose qui n'est pas quantifiable Qui est l'idiot dans l'histoire ?

119 .

>>118
C'est toi l'idiot

120 .

>>119
Non c'est toi.

>>118
Et toi aussi.

121 .

>>120
Casse-toi BDK

122 .

https://www.thedailybeast.com/nazi-sympathize...

123 .

https://www.earthcam.com/cams/newyork/timessq...

124 .

>>116
C’est sûrement la svastika indienne ou bouddhiste.

125 .

https://scontent-cdg2-1.cdninstagram.com/vp/9...

126 .

http://journals.sagepub.com/doi/abs/10.1177/0...

127 .

>>126
Donner un lien vers un article possiblement intéressant derrière un paywall. Vous n'êtes pas un gentilhomme.

128 .

>>127
http://sci-hub.tw/

129 .

https://www.youtube.com/watch?v=bQX1U_s4LyY

130 .

>>127
hurrr je veux que tout soit gratuit Tu as pensé à supporter les créateurs de contenu ?

131 .

>>130
Après une longue hésitation je suis venu à la conclusion que tu trollais. À quoi ça t'avance de pourrir la planche comme ça ?

132 .

>>131
Je pense que pour lui l'acrim' n'est qu'un bac à sable pour sa rhétorique.

133 .

>>132
Une sorte de cadavre exquis visuel, en quelque sorte.

134 .

donc à part en partant, non, on sera tjrs à plsr mais jcompte pas rester la soirée, juste 17h/19h sans doute.

135 .

wow j'écoute jul et ma mère a voulu noter son nom parce qu'elle a aimé ptdr

136 .

https://vocaroo.com/i/s0AwgwYvmxfN

137 .

https://www.youtube.com/watch?v=MusyO7J2inM

138 .

ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCA

139 .

https://www.youtube.com/watch?v=6JD9n6s4z-E

140 .

https://www.smbc-comics.com/comic/right

141 .

https://twitter.com/usuldufutur/status/948181...

142 .

Internet est perçu comme un lieu utopique de liberté où chacun peut s’exprimer, où il n’y a plus de différence entre les gens. Ceux qui ne sont pas célèbres ou qui ne sont pas puissants peuvent ainsi se venger d’une élite dont ils se sentent totalement exclus, grâce à l’anonymat. J’en ai fait l’expérience sur Le Plus où j’avais sans arrêt des remarques du genre « ha ha ha sémiologue qu’est-ce que c’est ? pour qui il se prend ? »

Ceux qui rejettent le système essayent de renverser les valeurs en s’en prenant non seulement au discours, mais aussi au statut. Ces comportements sont le symptôme d’un malaise social entre les élites et les simples citoyens. Ces derniers ne se sentent plus représentés et cela rejaillit partout sur Internet.

143 .

>>142
Voilà ce qui arrive quand on parle à des va-nu-pieds qui ont un cheveu sur la langue : ils n'ont pas de saussures.

144 .

https://www.youtube.com/watch?v=g2Uu-blw4oQ&a...

145 .

What the fuck did I just watch?

-Stupid Zombie bitches > CHECK
-Innocent nerd that died for nothing > CHECK
-Stupid tsundere died > CHECK
-Thot used is dead > CHECK
-Netorare > CHECK
-Poor dog > CHECK
-Bitch imouto > CHECK

ALL HAIL ICHIMICHI MAO

146 .

https://www.ccc.de/en/updates/2018/hausdurchs...
[totalitarisme s'intensifie]

147 .

A group of 3 yakuza failed their boss for the last time. After messing up an important job, the boss gave them 2 choices: honorably commit suicide, or go to Thailand to get a sex reassignment surgery in order to become "female" idols. After a gruesome year training to become idols, they successfully debut, with overwhelming popularity, much to their dismay. This is where their tragedy truly begins.

148 .

https://www.youtube.com/watch?v=wScyJp38XjE

149 .

http://www.vixra.org/abs/1806.0082

150 .

>>149
J'ai mis pas mal de temps avant de comprendre que je me faisais troller dure.
Les maths c'est vraiment devenu du shadok pour moi.

151 .

>>149
http://vixra.org/author/jonathan_w_tooker
Bordel, c'est un frakos ce gars, on est au-delà du troll de compétition, c'est de l'art.
D'ailleurs quelques redditeurs ont cru que le type se prenait au sérieux :
https://www.reddit.com/r/Physics/comments/1ws...

[quelques minutes plus tard]
J'ai trouvé sa chaîne youtube et voilà que je doute une fois de plus. C'est un troll ou pas, putain ?

152 .

Bernard Werber est battu, putain.

153 .

>>151
Je pense que c'est un putain de schizophrène, avant tout.

154 .

c'est juste très réducteur de penser à l'origine de la personne via la couleur de peau

155 .

http://is2.4chan.org/sp/1530883219313.jpg

156 .

>>155
France-Brésil 2-1 en demi ? Je prends !
Par contre pour la finale ils se touchent. C’est déjà un miracle que la Russie soit encore en course.

157 .

Je n'ai pas dit que ce comportement n'existait pas, mais que sa justification biologique nie la réalité sociologique et justifie les comportement abjects.
Nos sociétés sont patriarcales, je suppose que c'est une faute de frappe.

158 .

https://sonic-pi.net/

159 .

http://www.lesoir.be/166889/article/2018-07-0...

160 .

Micheline Tragédie

161 .

>>159
Et...?

162 .

Pounded In The Butt By My Reluctance To Buy A Humble Bundle Featuring Stories With Gay Characters As Though That Has Some Kind Of Bearing On My Own Sexuality Or The Quality Of The Product Then Eventually Realizing It's Pretty Good And I'm Fine
Chuck Tingle

Written exclusively for Humble Bundle, this powerful tale takes Gronto, an exhausted man with time to kill, on the erotic journey of a lifetime.

On his day off, Groto is excited to check out the latest Humble Bundle offerings, but when he finds one for world famous erotica author, Chuck Tingle, he doesnt know what to think. Gronto is strangely drawn towards The Tingleverse, but is also frustrated by the feelings this makes him confront within himself. Instead of buying the bundle, Groto heads to the park.
Soon enough, however, Gronto finds himself facing down his preconceived notions about the Chuck Tingle Humble Bundle head on, realizing that The Tingleverse is a place where everyone is welcome! Of course, it all culminates with a hardcore anal pounding that will push the boundaries of The Tingleverse to new and unexplored heights of meta!

163 .

https://www.youtube.com/watch?v=K7xarxyz9ro

164 .

>>163
Une bien belle chanson.

165 .

https://medium.com/the-mission/most-people-th...

166 .

https://pbs.twimg.com/media/DhaqyKOWAAEODOj.jpg

167 .

https://www.youtube.com/watch?v=-qW8DjR16-8&a...

168 .

https://www.youtube.com/watch?v=9pKAKwpKcfE

169 .

I want to end with a simple trick for you to realize how important sound design really is. If you have a surround system at home, turn off the center speaker. This way you can watch a movie without dialog. You will be amazed by what you hear. The chance is that you will watch the movie till the end. Now try the opposite, turn off all the speakers except the center speaker. All the sound design will be missing from the movie and you will just hear the dialog. Let’s see how long you can watch this. Now you know how important sound design is.

170 .

>>167
>>168
Putain mais quel fifrelin.

171 .

https://www.youtube.com/watch?v=16MMZJlp_0Y

172 .

>>171
anyone know what happened to it? Les gars qui savaient le faire sont partis à la retraite et n'ont pas laissé de doc

173 .

>>171
>>172
Les mecs qui ne comprennent pas qu'on puisse perdre une technologie de pointe, destinée à être utilisée une fois, sur laquelle plusieurs petites équipes différentes ont travaillé, dans le plus grand secret, avec une contrainte temps et sans communiquer les unes avec les autres n'ont jamais mené un projet de quelque ampleur que ce soit à bout.

174 .

>>171
Cela n'a rien de surprenant. J'ai entendu dire qu'il y a des sociétés dont les bases de données sont perdues car elles étaient programmées dans des langages informatiques tellement vieux que l'on n'arrive plus à trouver qui que ce soit qui sache les utiliser...
Il y a quelqu'un dans les commentaires de cette vidéo qui a posté quelque chose de censé (peut-être le seul) comme quoi la Saturn V et autres équipements étaient construits par des sous-traitants qui pour l'essentiel ont tous disparus, donc un grand nombre d'éléments importants du programme Appolo ne peuvent pas être reconstruits.

175 .

https://www.youtube.com/watch?v=RJqimlFcJsM

176 .

Si tout va bien, dimanche y’auras plus de racistes en France :). Merci les bleus !!!!

177 .

>>176
Pute ne sait pas pour le biais de confirmation.

178 .

https://pbs.twimg.com/media/Dcgt9A2XkAAL70E.png:large

179 .

>>177
Autre pute répondant ici, très intéressant anonsensei.

180 .

Are you ok?

No. I'm on a bunch of meds to deal with the problems this caused. I developed anxiety, depression, I hear voices, I have severe HPPD, I've gone into full psychosis several times, I lost my job, i developed DID and BPD, I spent 3 weeks in the psych ward, I lost all my friends, I don't know how to function in society, and now I believe entities are screwing with me.

181 .

https://imgur.com/gallery/tSKgjB8

182 .

>>181
... vraiment dommage que les jeunes découvrent internet principalement par ce site. Gâchis de toute une génération.
En même temps, comme c'est les jeunes eux-mêmes qui font ce site, on peut se demander si effectivement il ne faudrait pas la gâcher, cette génération.

183 .

>>181
Le mec a passé un quart d'heure à écrire des platitudes égotistes et même pas vraies, et, ce que je présume de par la manière dont il tourne ses phrases être une fille, de l'autre coté, a quand même été gentille avec lui. Quand je vois toutes ces conversations malaisantes, j'ai un peu moins honte des miennes.

Je sens que je vais partir en digression, mais je crois qu'aujourd'hui, le fait d'être obligé de communiquer en permanence par texte les uns avec les autres, en conjonction avec l'inaptitude de la plupart des gens à l'écrit, empoisonne les relations, et en particulier les relations amoureuses. Rien que les premiers échanges privés entre partenaires potentiels se font quasiment toujours par une forme ou une autre de messagerie. Ensuite, quand les choses sont établies, il est inacceptable d'utiliser lesdites simplement pour se coordonner (ce qui devrait àmha être leur principal rôle), et s'abstenir de se doucher mutuellement de salamalecs et de mots creux est perçu comme bouderie.

Combien de mes messages truffés d'innuendos subtils sont-ils passés inaperçus, et combien d'émoticônes ai-je peiné à interpréter ? Ce point-virgule narquois suivi d'une parenthèse souriante, mon pire ennemi, lorsque, au bout de chaque SMS que m'envoyait des semaines durant la petite rousse qui me servait de binôme ce mois de janvier 2017, je ne savais s'il m'invitait à déprofessionnaliser ce rapport, pour qu'au final ça ne devienne évident qu'à nos adieux, la veille de son départ pour Toulouse.

184 .

Un adolescent opéré d’urgence après s’être inséré un câble USB dans le pénis

185 .

>>182
Beaucoup de gamins surdoués finissent par développer une mauvaise relation avec le système éducatif ou la culture et les jeux vidéos à la con comme les communautés internet permettent de combattre l'ennui. Je vois ça plus comme un échec sociétal. Encore que on peut y faire des rencontres enrichissantes, faut savoir s'en distancer sinon ça craint vraiment.

186 .

>>182
>>183
>>185
Oui je vois. C'est vraiment super cool.

187 .

>>185
Beaucoup Un tiers.

188 .

>>187
Vieille stat et ça reste beaucoup, marchande avec ça.

189 .

>>183
malaisantes J’ai arrêté de lire ici.
Quelqu’un pour faire un tlpl ?

190 .

>>189
Je peux te le faire moi-même, en gros la suite de mon message est une divagation sociologique lambda, un peu malaisante en son genre aussi, sur l'incapacité des gens à communiquer de façon satisfaisante par écrit.

191 .

https://twitter.com/CaptainClito/status/10177...

192 .

>>190
malaisante J’ai arrêté de lire ici.
Quelqu’un pour faire un tlpl ?

193 .

>>193
http://www.reddit.com/r/lewronggeneration

194 .

ENORME FRAUDE!! COMPTEUR BLOQUé totalement sur 1869 vues ! ( le 07/07 à 23h ) …. avec régulièrement plusieurs BAISSSES de vue par la pute faussaire ! * voir CAPTURES dans les Réponses de ce comm. ……………. et compteur SOUVENT BLOQUé pendant 1 H ou 2 h (bloqué sur 1741 vues depuis des heures !) ...OU MIS AU RALENTI MAXIMA !!! ! par la pute faussaire…. avec baisses de vues! le 27/0 , le 22/06 , *VOIR CAPTURES D' ECRAN DU COMPTEUR BAISSé !!!!!(voir les dates t et heures MISES EN COMM REPONSES DE CE COMM ! , .. .. ( le 22/06 nouvelle baisse du ompteur de vues par lordure 1581vues , baissé à 1478 dans la soirée!!!!(Voir les captures d'écran en comm réponse de ce comm! pour preuves !) et le 20/06 , le compteur était sur 1497 vues à 14h l..puis baissé sur 1447 vues à 15 h.... pusi baissé sur 1315 vues à 15h 45... ( toujours le20.06 ) !!!... …idem le jour d'avant pour cette même vidéo ; . 1262 vues à 10h 45 (le 18/06) BAISSé!!! à 1548 à 2 s0h44 !!!!. .. ai les captures décran (voir mes comm cidessous !...….!. OU COMPTEUR MIS AU RALENTI MAXIMA ! par la pute faussaire (= 1 à 5 (ou parfois 10 vues par heure ( rarement plus, )quand il veut faire croire i que la vidéo n'est pas bloquée ;.. )!!..........il suffit de voir le score ! 1151 vues à 19h pourr ce 5ème jour de publcation , avec 1547 abonnés ,concédés pour voir la fraude ! plus AUCUN COMM depuis plusieurs jours, tous supprimés! ….(. .vidéo bloquée aussi totalement sur 842 vues le 15/06) de 20h à 22 h 45 ! ….. lordure a aussi bloqué TOTALEMENT le compteur vues durant toute la matineé du 15/06 jusquà 13h, 30 … donc mes vdiéos sont bloquées plusieurs heures d'affilée plusieurs fois par jour ! toute la matinée, e toute la soirée .........la .pute faussaire .qui a aussi bloqué cette vidéo toute la journée du 14/06 (=2ème jour de publication ) et l'a débloquée uniquement le 15/06 à 0h15 , mais pour METTRE LE COMPTEUR TRES AU RALENTI , ,ne rêvez pas ...…. donc vidéo publiée le 13/06 à 19h10..et à 20h 15 : 130 vues et 25 likes, (=1 h après que jai publié la vidéo )… ….. à 23h : 293 vues , 1534 abonnés (compteur abonnés bloqué !) . vidéo avec compteur vues déjà très ralenti ,, ca r le rythme au lieu d 'augmenter , a baissé depuis les 2 première heures ;.! ;.. le lendemain 14/06 à 20h10 seulement 679 vues !! après 25 h de publication , alors que 130 vues après 1 h de publication dès hier soir ;.et compteur bloqué sur 679 vues toute la journée ;.. la fraude est énorme .et de plus en plus dégueulasse ;. et sous mes vidéos (plus d ecomm depuis le 1er jour de publication , nombre abonnés quasi bloqué ( abonnés, likes , vues

195 .

les monnaies ne devraient pas etre des marchandises

196 .

>>195
Pourquoi pas?

Le mot "marchandise" ne devrait pas être perçu péjorativement.

197 .

>>195
Si tu coupes l'équivalence entre deux devises, tu annules purement et simplement tout le commerce mondial.

198 .

https://www.youtube.com/watch?v=8BLuW8ygXzE#t=17m13s

199 .

>>198
Cette voix, putain. Un homme pensant.

200 .

Bonsoir à toutes et à tous.

C'est pour vous un énième topic comme tous les autres dans son genre, mais pour moi il est important, un peu comme un naufragé écrit son nom sur un morceau de bois, juste au cas où on me lise.

Vous vous doutez bien que c'est à cause de la coupe du monde. Cette foutue coupe du monde où mon monde a basculé ce soir. Je ne dis pas à tort que c'est exclusivement à cause d'elle, mais ça a été l'élément déclencheur, le morceau de trop qui me fait tout dégueuler ce soir.

Je ne sais pas par où commencer, je me contenterai d'une bête énumération. J'ai beau avoir réussi dans les études: classe prépa et écoles prestigieuses très cotées, bon salaire, il n'empêche que je n'arrive pas à trouver ma place dans cette société pour la bonne raison que je la déteste.

Elle ne se pré-occupe que de choses futiles, elle bouffe, elle rote, elle baise et elle chie en toute quiétude sans chercher à s'élever au dessus du stade de l'animal.
On ne fait que parler du foot. Pourquoi n'a t-on pas autant parlé de la découverte des molécules organiques sur Mars, dont il est plus probable vu leur complexité qu'elles soient d'origine vivante que géologique ?

Pourquoi on fait tous comme si la vie était belle alors qu'un désastre climatique sans précédent arrive sur nous à toute allure ? Tout le monde se moque des conflits qui déchirent la Syrie, Gaza, des politiques qui nous privent peu à peu de nos libertés, d'une manière si habile qu'on ne s'en rend pas compte.

Je ressens le même sentiment que si après avoir passé 10 ans à peindre un chef-d'œuvre un enfant de 2 ans le recouvrait en quelques secondes de ses déjections, en se demandant une minute plus tard le regard hagard pourquoi il a fait ça.

Je ne peux pas vous résumer en quelques lignes mes 24 ans d'existence. D'une manière très concise je dirais que je suis quelqu'un de réservé. J'ai commis l'erreur d'être gentil en général dans mes années collège et lycée, et j'ai vu que ça ne faisait que m'attirer des ennuis et des déceptions: je me faisais harceler, ne répondant pas persuadé que la violence n'était pas une solution, et que les mots allaient tout résoudre. Les rares copines que j'ai eu m'ont quitté car -encore une fois- trop gentil à leur goût. Vers mes années supérieures, je suis devenu un fifrelin. Il faut dire que ma capacité à changer de personnalité, à me calquer sur celle des autres m'a vraiment aidé pour ce coup là. Ce qui pour moi était au début un jeu d'acteur est devenu ma seconde nature. Et le pire c'est que ça a fonctionné. Je ne sais pas qui de la méchanceté ou de la confiance en soi qu'elle apporte m'a aidé, mais je n'ai jamais été aussi populaire, je ne suis jamais autant sorti avec de filles depuis que je suis un macho go muscu, qui s'enfile des bières avec ses amis yes-life. Ce fonctionnement a actionné en moi un cercle vicieux: cela me dégoutait de voir que ça marchait mieux ainsi, je devenais donc encore plus aigri et superficiel avec le temps, ce qui plaisait davantage. Me dégoutant à nouveau et ainsi de suite.

Je me suis menti à moi même pendant 7 ans. Allant à des soirées côtoyer des gens que je méprisai au lycée, faisant semblant de m'intéresser à leurs insignifiantes passions, toutes identiques: voyager, les voitures, Netflix et les boîtes de nuit. Plusieurs fois j'ai failli être démasqué en tentant de parler de choses plus profondes, mais ne vous y méprenez pas: les gens superficiels, aussi proches de vous soient-ils vous éjecteront de leur cercle sitôt que vous vous éloignez de leurs standards.

J'ai commis l'erreur de me mettre en couple avec une fille de ce genre.

Je suis pourtant comblé, au lit, en soirée, par messages, mais ce qui me manque c'est de jouer en permanence ce rôle (même si je le joue très bien). Je suis un imposteur et je me suis fourvoyé. J'ai cru qu'elle était différente. Pourtant ce soir elle ne s'est pas gênée pour me tromper sans aucun état d'âme. Je l'ai appris de sa meilleure amie, sensiblement différente. L'amie moche vous savez, mais qui au moins est psychologiquement plus proche de moi. Ce genre de fille qui voit bien que ça cloche dans son cercle, mais qui n'en sort pas par peur de finir seule.

J'ai eu le droit à un mensonge vaseux puis à de piteuses excuses dont le fameux "c'était la fête, j'ai pas fait exprès".

Soudainement, c'est ces 7 ans d'impostures qui tombent. Je vois enfin ce que j'avais sous les yeux et que je refoulais au fond de moi-même: les hommes d'aujourd'hui sont des merdes, des porcs parqués dans une société sans morale et superficielle, des filles qui se dévergondent au nom du progrès, des gens qui oublient les sentiments, sans aucune empathie, rien.

C'est comme si j'étais au paradis et qu'après avoir gratté le sol je n'y trouvait que des millions de cadavres noyés dans de la cendre.

Et ça, j'ai l'impression que c'est récent. Il n'y a avait pas ça il y a 100 ans. Je regrette de ne pas être né en 1900. Enfin c'est un exemple.

Je n'attend pas grand chose de vous, je voulais juste témoigner. Vous n'êtes pas seuls. Assumez qui vous êtes, montrez vous au grand jour, ignorez ces yes-life qui ne vivent que pour le lendemain, et qui itèrent leur cerveau quotidiennement basé sur la journée écoulée.

Désormais je n'en ai plus rien à foutre, je suis qui je suis, je vais leur sortir leurs 4 vérités à tous et je pars réaliser mon rêve: vivre en ermite sur l'île de Saint-Hélène. Le retour à la terre.

201 .

D'accord avec tout sauf ça :
Et ça, j'ai l'impression que c'est récent. Il n'y a avait pas ça il y a 100 ans. Je regrette de ne pas être né en 1900. Enfin c'est un exemple.

202 .

>>200
C'est un sentiment qu'on est plusieurs à avoir ressenti à un moment ou à un autre, en témoignent les dizaines de messages de ce genre depuis le début de l'Acri, et même déjà discrètement sur UF, dont je dois avouer que deux ou trois étaient de moi. Si j'ai bien compris, tu as réalisé très tard que tu pouvais t'affirmer, et tu n'as pas encore trouvé l'équilibre entre être le paillasson amorphe qu'on a tous été un temps et le go muscu mégalo insupportable, donc les relations que tu parviens à former pour l'instant sont très superficielles et à partir des données que tu as à disposition tu en déduis que la société est constituée de gens superficiels. Je suis passé par là aussi, un peu après mes vingt ans, et je t'assure que le problème c'est au moins en partie ton attitude.

Je me permets de te dire ça parce que ta manière de t'exprimer, le vocabulaire que tu utilises et le fait de nous poster ta complainte un dimanche soir festif est le reflet de ta vision du monde et de ton humeur, qui sont un peu chamboulées en ce moment, et ce n'est certainement pas la dernière fois que ça t'arrive. Tu as visiblement la capacité de prendre un peu de recul sur ce qui se passe dans ta tête, ça t'avantage déjà pas mal par rapport à la plupart des gens, mais il faut te servir de cette capacité d'autant plus que tu traverses des émotions intenses, qui comme chacun sait déforment tout.

Si tu es un jeune ingé, cadre, consultant ou équivalent, tu as forcément des opportunités de rencontrer des gens bien dans ta vie professionnelle, mais si tu donnes l'impression d'être un incompétent social ils ne s'ouvriront pas et tu n'auras jamais l'occasion de les différencier de tous les autres visages inexpressifs.

Je ne vais pas retaper un pavé alors que je devrais dormir (hé hé), mais j'ai déjà posté plusieurs compilations de conseils sur l'entraînement aux compétences sociales, l'humilité et la bonne attitude en général dans la vie, qui sont assez faciles à retrouver parmi les longs murs de texte au milieu des pensées des dernières années. Tu es insatisfait de ta situation, la solution n'est pas de t'isoler mais de devenir la personne rare que tu as évidemment le potentiel et le devoir d'être d'ici tes trente ans.

Je t'assure que tu n'es pas le seul à n'en avoir rien à foot. Moi-même, à l'heure du match, j'étais à l'audition d'orgue hebdomadaire de Baptiste-Florian Marle-Ouvrard (je vous recommande d'y assister un de ces dimanches, je ne pourrais pas y retourner avant mi-Août mais c'est vraiment sympa), à Saint-Eustache, à quelques centaines de mètres d'une foule de supporters, dont le bruit insensé comblait les silences dans la suite en ré majeur de Bach, et je n'étais pas le seul jeune homme bien à y être indifférent sur ma chaise en paille au milieu des vieux cathos. Il y avait même quelques filles jeunes, jolies, d'apparence humble malgré la chaleur, et qui ne sont pas toutes restées pour la messe.

203 .

https://www.instagram.com/p/Bk3UrNGFP1r/

204 .

>>202
Je vois pas pourquoi tu parles d'entraînement aux compétences sociales, j'ai pas du tout l'impression qu'il parle de ça.
C'est même plutôt le contraire.

205 .

>>204
Ce que je comprends de son post, c'est qu'il s'est dévergondé et se force à être comme ces mecs déjà lourds dès la puberté, qui ne murissent pas avant la trentaine, qui baisent en effet beaucoup avec beaucoup de partenaires différentes sans substance (et avec trop de substances), ceux qui deviennent de misérables beaufs au fur et à mesure que leur mode de vie les abime, en fait. Ânon n'est pas comme ça au fond de lui, ça ne le satisfait pas, mais il ne connaît que ça malgré son niveau d'études.

C'est une forme d'incompétence sociale que de ne pas être capable de s'intégrer parmi des gens qui partagent tes centres d'intérêt et son niveau intellectuel. Il a plus de compétences sociales qu'avant, mais il n'est pas sincère, et il doit avoir tellement de schémas comportementaux désagréables que ça entrave ça capacité à s'entendre avec les gens merveilleux qu'il croise certainement tous les jours. J'ai vécu la même chose pendant un peu plus de deux ans, et les relations que j'ai formé à cette époque n'ont pas tenu, parce qu'au premier signe de bienveillance et d'honnêteté le beauf en devenir se sent méprisé ; en vérité c'est son propre mépris de sa propre médiocrité qui le pousse à s'écarter et à ne plus répondre aux invitations de ceux qui la lui rappellent.

Je suis dans une période Kundera, ça se sent ?

206 .

>>204
Enfin, je viens de réaliser que pour un psy, l'intervention à laquelle je pense serait plutôt un genre de thérapie des schémas que de l'entraînement aux compétences sociales. Ce n'est pas mon métier, donc j'emploie parfois les termes à ma guise.

207 .

https://www.youtube.com/c/SexyCyborg

208 .

https://twitter.com/TheDailyShow/status/10190...

209 .

>>207
Dafuq did I just watch?

210 .

http://www.soulcie.fr/portfolio/netflix-la-ma...

211 .

https://www.internetisshit.org/

212 .

>>211
Bébé vieillit et découvre que le fric pourrit tout.

213 .

>>211
Plus bel enfonçage de portes ouvertes jamais.

214 .

>>212,213
Ce n'est pas forcément mal de rappeler quelques évidences qui n'en sont pas pour tout le monde. Ce qui est déplorable c'est que ce message n'atteindra sans doute pas ses cibles idéales.

215 .

>>214
Ce phénomène a d'ailleurs certainement un nom, non ? Le fait que certaines choses évidentes à une population A soient à la fois davantage nécessaire à une population B, notamment parce qu'elle l'ignore et/ou s'en fiche. Si quelqu'un peut mettre un nom là dessus, je lui serai très redevable.

Genre les sportifs savent à quel point le sport est sain et important, et ce sont justement les non-sportifs qui ont le plus besoin d'accepter cette information.

216 .

davantage nécessaire et globalement ignorée*

217 .

>>215
Ce que tu décris n'est-il pas un peu tautologique à toute connaissance ?

218 .

http://www.francesoir.fr/politique-france/1er...

219 .

>>217
Oui, le post de >>215 était un bel enfonçage de porte ouverte.

220 .

>>217
Non, c'est un cas de figure déterminé. Tu n'as pas besoin de toutes les connaissances que tu n'as pas, loin de là. Tout ce que tu ignores de l'astrologie ou de l'histoire des Mayas ne présente aucun manque à gagner (du moins, qui ne soit directement mesurable

221 .

https://www.youtube.com/watch?v=u_DN6Q_5Lgg&a...

222 .

https://www.youtube.com/watch?v=ezMYhVwqG1I

223 .

https://www.thescottishsun.co.uk/dear-deidre/...

224 .

http://www.bristol.ac.uk/news/2018/july/secul...

225 .

https://www.youtube.com/watch?v=fQeCdU0ubBk

226 .

Pour me présenter brièvement -et surtout physiquement-, j'ai 20 ans, je suis une étudiante infirmière. Je mesure 1m76, je suis mince et j'ai une silhouette élancée, de longues jambes fines, des hanches larges avec de discrètes poignées d'amour mais une taille très creusée, un ventre plat, 'une jolie poitrine ferme (90C), un cul rond'. J'ai de longs cheveux châtains, qui vont du châtain sombre au châtain doré. J'ai une peau claire mais légèrement bronzée, un teint "halé". J'ai des yeux noisettes, ce qui est plutôt banal mais on me dit régulièrement que j'ai un "beau regard" ou des yeux "charmeurs". Je n'ai pas un visage transcendant, mais il est bien équilibré, il est plutôt fin, avec une bouche bien dessinée et naturellement rouge, des pommettes hautes et saillantes. Bref, dans ce monde où l'on fait systématiquement l'apologie de la beauté, je suis "belle".

Par belle, j'entends que je correspond aux critères qui sont fait par la plupart des magasines, par le cinéma ou nôtre culture actuelle, ici en France en tout cas. Je n'ai pas pour prétention de dire que je suis irrésistiblement irrésistible et que la simple vision de mon corps de naïade vous transportera au paradis. Çà c'est entièrement faux. Les goûts de chacun sont différents, je parle donc ici par "beauté" simplement de "standards".

Je ne m'habille jamais vulgairement, mais il m'arrive de porter des talons, des jeans "slims' et des débardeurs légèrement décolletés. Des dos nus en été, ainsi que des robes ou des shorts. J'aime être féminine même si je n'ai jamais eu besoin de porter des choses très élaborées pour qu'on me remarque, d'ailleurs là où l'on me trouve la plus belle, c'est justement quand je vais porter des choses très très basiques tels que le classique jean-bleu/débardeur-blanc.

Voilà, seulement à part faire le bonheur des vendeuses dans les boutiques de prêt-à-porter, je vis cet aspect de mon physique comme un véritable complexe. Et ce, pour de multiples raisons.

Tout d'abord, et ce qui me pose le plus de difficultés, c'est la manière dont cela altère mes relations avec les autres. Presque toutes les filles de mon âge qui sortent juste de l'adolescence et on encore pour la plupart de nombreux complexes ne me supportent pas. Rarement, elles cherchent à vraiment me connaître. Toutes les filles "banales" que je rencontre, celles qui ne sont pas particulièrement jolies, mais sans nécessairement être "moches" me tournent le dos. Comme si ma présence les hérissait. Aujourd'hui j'associe souvent ça à de la jalousie même si pendant un long moment je me suis beaucoup mise à douter de moi-même, pensant que je n'étais peut-être pas assez "sympathique" ou des choses comme ça.

Mes seules amies sont des filles bien dans leur peau, équilibrées sur tous les plans, qui s'assument pleinement et s'aiment même malgré leurs complexes. Je m'entends merveilleusement bien avec ce type de "forte personnalité", ces filles qui n'ont pas besoin qu'on leur dise qu'elles sont jolies pour se sentir exister. Elles m'acceptent sans problèmes et on adore sortir ensemble, nous ne sommes pas jalouses les unes des autres et tout se passe à merveille. Et justement, elles découvrent ainsi à la fois mes qualités mais aussi mes défauts ! A leurs yeux, je suis "humaine", et c'est vrai que ça me fait un bien fous de savoir qu'elles me considèrent comme tel !

Dans mon école d'infirmière où je suis récemment entrée, ce n'est malheureusement pas le cas. J'ai le droit aux regards de biais et aux scrutages en règle par les autres filles de l'école. J'ai vraiment l'impression de les agacer, comme si ma simple présence les rebutait ! Même lorsque je ne parle pas, ne fait strictement rien de déplacé, elles ont l'air de désapprouver le fait que je me tienne dans la même pièce qu'elles ! Du coup, je suis plutôt effacée, silencieuse. C'est difficile à vivre et ça ne m'aide pas à m'épanouir ni à me faire de nouvelles vraies amies.

Ensuite il y a le regard des gens de l'extérieur. Je suis très souvent abordée dans la rue, fréquemment on me sort les habituelles phrases à "la con" du style "Eh salut mademoiselle, t'es vraiment charmante !", "Madame t'es trop belle !" "Est-ce que vous seriez intéressée pour un verre ?" ou encore "Eh dîtes, on se serait pas déjà croisé une fois ?". Il y a aussi les coups de Klaxon, infernaux. J'ai 500 mètres à traverser le long d'une route plutôt fréquentée pour aller jusqu'au centre commercial le plus proche de chez moi où je fais mes courses. '9 fois sur 10, on me klaxonne soit à l'aller, soit au retours, voir les deux.'

Et puis il y a les boites de nuit, dans lesquelles mes amies m'ont surnommées "l'aimant-à-mec". Dès que je danse, il y a cercle autours de moi, c'est généralement au moins 3 ou 4 garçons qui tentent de venir danser avec moi, de se frotter contre moi ou encore de m'embrasser. Je ne suis jamais tranquille ! C'est déjà arrivé que je danse avec quelqu'un, sans aucunes arrières pensées de ma part, et donc que je me mette à danser avec quelqu'un d'autre un peu après. Et là, souvent les deux jeunes hommes commencent à se bousculer pour tenter de m'avoir en exclusivité pour la danse, allant jusqu’à se battre parfois. C'est totalement ridicule mais il m'est même arrivée de me prendre une baffe comme ça, alors que deux types ont carrément commencé à se donner des coups pendant que j'étais encore entre eux deux.

Sans compter que certains mecs de mes amies m'ont fait des avances, ce sont des situations hyper déplacées dans lesquelles je suis toujours ultra gênée. J'ai pour ma part toujours regardé d'un oeil mauvais les filles qui volaient les copains des autres, seulement le nombre d'hommes mariés ou de mecs en couple qui me draguent est totalement hallucinant.

C'est une des choses aussi qui me fait perdre confiance dans les hommes et en l'amour. Parfois je suis découragée, j'ai l'impression que l'amour n'existe que dans les films. Plusieurs fois, des hommes en couples qui venaient à peine de me rencontrer on voulu m'embrasser en m'annonçant qu'ils étaient prêt à tout quitter pour moi. Disant parfois des choses horribles et hyper intimes sur leur actuelle copine pour me prouver qu'au final ils ne l'aimaient plus ! Mais comment pourrais-je me confier et être avec quelqu'un qui était dans une relation 5mn plus tôt, certainement avec une fille qui devait l'aimer, puis que l'instant d'après il soit prêt à tout plaquer uniquement parce qu'il rencontre une nana qu'il trouve plus "belle et intéressante" ? J'ai peur que moi aussi un jour ce soit mon tour, qu'il me quitte du jour au lendemain pour une fille "plus belle" que moi.

Et puis, on ne vois à travers moi que de ma "beauté", et surtout mon corps ! Limite, mon visage en devient totalement accessoire. Les compliments les plus fréquents sont "tu as de très belles fesses", "tu as des seins magnifiques", "tu as des jambes de rêves" "j'adore ta taille de guêpe". D'accord, mais et mon sens de l'humour ? Mon imagination ? Ma gentillesse ? Je ne pense pourtant pas n'être que ça !

Je ne suis pas non plus une mademoiselle-parfaite. J'ai des défauts, plusieurs. Cependant qualités comme défauts sont très souvent passés à la trappe. Récemment quand j'ai annoncé en public que j'entamais une formation pour devenir infirmière, on m'a aussitôt dit "Wohh ! Vous ferez une très belle infirmière !". Voilà, pas une "bonne infirmière", mais une "belle infirmière". J'ai l'impression de n'être résumée qu'a ça ! Même mon médecin traitant, quand j'ai annoncé que j'allais changer de médecin pour un plus proche de chez moi, m'a simplement dit "Oh non, vous étiez une jolie patiente ! C'est dommage".

En plus de ça, je n'arrive pas à avoir de vraies relations avec des hommes. Déjà car comme je l'ai dit plus haut, j'ai énormément de mal à faire confiance à ceux qui me draguent très ouvertement car souvent ce sont ceux déjà en couples, mais surtout parce que je semble intimider tous les autres ! Un garçon qui me plaisait beaucoup au lycée m'a annoncé via facebook et après le bac qu'il avait craqué sur moi toute l'année de terminal mais que comme j'avais l'air de ne pas vraiment être intéressée, il n'avait jamais osé se lancer. Oui sauf qu'après ça, lui était parti étudier dans une ville à l'autre bout de chez moi.

Pareil l'autre jour en soirée, j'ai rencontré un type mignon, sans plus, mais qui avait l'air vraiment sympa. J'ai commencé à vouloir flirter, il a d'abord semblé surpris puis à commencé lui aussi à entrer dans mon jeu avant de finalement me lâcher un "je suis vraiment désolé, mais en fait, tu es trop belle pour moi", avant de prendre la fuite ! Au début j'ai pris ça pour une manière polie de me dire que je ne l'intéressais pas, puis après en avoir discuté avec des amies dont une de ses amies à lui, j'ai compris que le problème était bien là. Il m'avait trouvée "trop" belle. Trop, c'est de la démesure, c'est par définition le contraire de bien. C'est comme n'être "pas assez" belle. Au final qu'on soit trop belle ou trop moche, les difficultés sont identiques.

Donc voilà où j'en suis, impossible d'avoir des relations amoureuses et les relations amicales sont plus que compliquées ! D'ailleurs contrairement à ce qu'on pourrais penser, le fait que j'ai peu d'amies filles ne veux pas dire du coup que j'ai pleins de potes mecs, justement car il est super-compliqué d'avoir une relation simplement amicale avec un garçon, en tout cas dans la durée. Presque systématiquement, mes "amis" finissent par me faire des avances.

Je suis plutôt isolée et donc aussi frustrée. Parce un tas de filles beaucoup moins "jolies" que moi et parfois carrément moins sympa (des filles odieuses qui se la pètent, j'en ai à foison là où je suis !) ont très souvent des mecs, alors que moi, impossible !

Cette situation est super difficile à vivre. Et je ne me vois pas me défigurer au cutter le visage et les jambes non plus. Surtout que je ne souhaite pas être moche, juste être comme tout le monde ! Ne plus être le genre de fille qu'on va systématiquement remarquer et sur qui on va régulièrement se retourner. La nana qui se fait mater dès qu'elle passe devant la terrasse d'un restaurant où qui se fait zieuter dans le tram dès qu'elle regarde par la fenêtre. Je voudrais que les garçons n'aient plus peur de me séduire, qu'ils apprennent à m'apprécier pour ce que je suis vraiment et pas parce que je suis "belle". Je voudrais ne plus avoir à galérer pour m'intégrer dans ma classe, où toutes les filles ou presque me tournent le dos.

Voilà, je sais que quand je dis que je suis belle, ça peut être très subjectif. Seulement le harcèlement de rue, les copains des copines qui me draguent, les gens qui s'étonnent de manière presque vexante quand je dis que je n'ai pas de copain, les amis de mes parents qui me rabâchent que je devrais laisser tomber les études pour faire du mannequinat et les filles qui me dévisagent presque avec hargne alors que je ne les connais même pas, ça, c'est un constat.

J’espérais donc recueillir des conseils intelligents autres que "porte un sac poubelle sur la tête" "maquille toi pour te faire moche" et des choses du genre. Je ne veux pas changer ce que je suis, je suis néanmoins consciente que si beaucoup de filles sont jalouses c'est parce qu'elles aimeraient être physiquement comme moi. Je ne veux pas les insulter en disant que tout ça je m'en fiche et que je n'en veux pas du tout. Etre mince et grande c'est pratique et ce n'est pas négatif en soi. Seulement j'aimerais trouver un moyen ou une astuce pour que le regard des gens change, pour qu'ils voient au delà de mon physique.

227 .

>>226
Wow merci d'avoir c/c ce témoignage, ça fait un bien fou.

228 .

En vrai je pense que ce genre de fille devrait faire du mannequinat, ne serait-ce que pour rencontrer des filles encore plus belles et apprendre de leur expérience.

229 .

Ce message a été effacé.

230 .

>>226
J'ai une amie comme ça. Les mecs qui l'intéressent se cachent de sa vue alors qu'elle se fiche du physique.

231 .

https://blogs.mediapart.fr/pierre-haffner/blo...

232 .

>>230
Dis-lui d'aborder les mecs qui l'intéressent, ça rendra service à tout le monde.

233 .

>>232
Elle l'a déjà fait et si j'ai bien compris, le cas de figure vu dans >>226 s'est produit quelques fois.

234 .

https://www.youtube.com/watch?v=A5eRXIWqRT8&a...

235 .

Arri 650w Fresnel

236 .

Wine tasters are often haunted by the ghosts of the grapes they drank.

237 .

http://www.politicoboy.fr/emmanuel-macron/qui...

238 .

age is just a number
jail is just a room

239 .

https://sciencevsmagic.net/castles/

240 .

LF393549365CN

241 .

http://www.leparisien.fr/val-de-marne-94/cret...

242 .

>>241
Faut croire que les flics préfèrent tabasser des manifestants plutôt qu'aider des Asiatiques.
Question de priorités.

243 .

>>241
Serait-ce un embryon de guerre des races ? Je vais de ce pas acheter des armes et de la nourriture déshydratée.

244 .

>>240
ça devrait arriver bientot

245 .

https://www.youtube.com/watch?v=tIsEZkoBBpU&a...

246 .

https://code-rood.org/index.php/en/success-code-rood/

247 .

“The rhetoric that is espoused by people who defend intellectual property law is that this is theft,” Laufer told me. “If you accept that axiomatically, then by the same logic when you withhold access to lifesaving medication that's murder. From a moral standpoint it's an imperative to enact theft to prevent murder.”

“So yeah, we are encouraging people to break the law,” Laufer added. “If you're going to die and you're being denied the medicine that can save you, would you rather break the law and live, or be a good upstanding citizen and a corpse?”

248 .

Tsundoku

249 .

Paolo Conte sparring partne

250 .

$\mathds{R}_\text{an}$ est o-minimale.

251 .

ikipedia says I'm an Artificial Intelligence researcher. The TVTropes page on me lists me as a Science Hero. The highest upvoted item on the Eliezer Yudkowsky Facts page says, "If you say Eliezer Yudkowsky's name 3 times out loud, it prevents anything magical from happening."

If you succeed in purchasing me, I come with an optional bisexual girlfriend named Erin. We're polyamorous and are looking for new friends and dating interests both singly and as a couple.

252 .

https://www.youtube.com/watch?v=Et3lzkoM_tw&a...

253 .

https://www.nbcnews.com/health/health-news/pa...
"développement personnel" hahaha VA PLUTÔT BOUFFER DE LA MERDE DE CHAT

254 .

http://holocaustcontroversies.blogspot.com/20...
Les nazis remercient twitter

255 .

bouillouses

256 .

si vous deviez en venir aux mains contre un chimpanzé, selon certains biologistes, ce serait comme de se battre contre un haltérophile olympique de 130 kg avec les réflexes d’un gardien de but

257 .

>>256
Comme quoi l'évolution biologique qu'on attend des humains c'est bien de devenir de plus en plus faibles physiquement.
Les masculinistes et autres virilistes, PUA et compagnie veulent donc bien faire régresser l'humanité.

258 .

>>257
Les chimpanzés ne savent ni lire ni écrire, preuve que tu cherche à faire régresser l'humanité avec tes messages :^)

259 .

>>257
MessageApprouveParBernardWerber.jpeg

260 .

>>259
Si les chimpanzés avaient appris à respirer sous l'eau, ils auraient cassé la gueule des dauphins.

261 .

>>260
Riz.

262 .

A Trump supporter on Twitter was saying to me that America hadn’t had any school shootings in a while and that Trump must be doing something right and people should give him credit for that, and I had to remind him that it was summer.

263 .

http://mamynoha2.m.a.pic.centerblog.net/f05ece8a.gif

264 .

https://www.flickr.com/photos/limityjsmemy/

265 .

https://lwn.net/Articles/761100/

266 .

http://www.dailymail.co.uk/news/article-60034...

267 .

https://www.francetvinfo.fr/meteo/canicule/l-...

268 .

>>267
On est quand même sur de la thermodynamique niveau CE2, là. À quand l'étude du CNRS qui mettra en évidence que l'eau bout à des températures plus basses en montagne ?

269 .

https://www.dailymotion.com/video/x2t0zwi

270 .

https://twitter.com/UthmanG1/status/102421003...

271 .

>>269
Oh bah merde j'ai pas le droit de manquer de tuer un type parce qu'il a agressé mon amie mais pourquoi ?!!
>>270
Elle a raison et sa citation est tronquée.

272 .

>>226
Ça sort d'où ? Je suis curieux de voir les réponses données (si tant est que ça ait été posté sur un forum)

273 .

https://news.ycombinator.com/item?id=17656074

274 .

. Central to Butler’s analysis of self-love is his extremely influential dismissal of psychological egoism — in C. D. Broad’s words “he killed the theory so thoroughly that he sometimes seems to the modern reader to be flogging dead horses” (Broad 1930, 55; but see Penelhum 1985; Henson 1988; Sober 1992). For Butler, the kind of egoism exemplified for him by Hobbes — “the selfish theory” in eighteenth century parlance — rests on the failure to distinguish principles from passions. There is a trivial sense in which all of our passions are our own and the pleasure we have in discharging or pursuing any passion is “self” love. But it is also uninteresting: we can’t conclude much from the fact that every passion we take pleasure in is our passion. We certainly can’t conclude that human beings are always motivated by selfishness. That selfish theorists thought we could was due in part to their confusing the “ownership of an impulse with its object” (Broad 1930, 65)—the inference from that the passions are ours to that we are the objects of the passions. Although the passions belong to us it does not therefore follow that our “self”, or our self-gratification, is the object of the passion.

275 .

So I take this girl out to a bar/restaurant, meeting her for the first time after talking on an online dating site. After she orders her food, she drops the bomb. She tells me for the past 7 years, she has been a professional dominatrix.

So I'm an open minded guy, I'm cool with this. She probably has some funny stories right? Well. She starts telling me these stories, and for the first half hour or so, they are pretty entertaining. Eventually though, I want to talk about other things. However, anytime I try to change the subject, she immediately brings it back to dudes she pooped on. It got weird, I could barely get a word in. She basically didn't take a breath for 3 hours. Again, I'm a really open minded guy. But there's only so many consecutive stories of ball gags and double sided dildo butt fucking a person can take before even the most open minded amongst us start to feel uncomfortable.

At one point, I excuse myself to go to the bathroom. As I stand up and turn around, she seizes this chance to smack my butt and says "your ass looks like a baby pumpkin. I could bounce a quarter off it and get back 2 dimes and a nickel!" Keep in mind, this lady is a PROFESSIONAL. It was crisp and painful. To put this in perspective I was wearing thick jeans, she hit me in my back pocket, and when I checked myself for damage in the bathroom there was a clear fat red handprint on my butt cheek. Like, I could see the lines in her hand. I could have mooned a psychic and they would have been able to predict her future.

So I'm about done with this. We finish the meal and I drive her home, while she still blabs tales of donkey tail butt plugs and toys I've never heard of going in places I wish I hadn't heard. So I pull in her driveway....the second the car goes into park she immediately grabs my nuts. Like specifically targeted them. And it wasn't sexy, it was a hostage situation where she had all the power. Then she straight licks the side of my face, chin to hairline, her tongue as big as a Shetland pony. I do not want. Then she looks me in the eyes and says menacingly "I'm gonna strap you into my sex dungeon!"

"The fuck you are, I choose LIFE!" I think to myself. How do I get out of this? She literally has me by the balls here. So here's what I come up with. I tell her that "hell yeah, let's do it! I have a special toy I keep in my trunk, is that okay?" She says "sure, bring any toys you want!" So I tell her to meet me at her doorstep while I bust it out because I want it to be a surprise. As she steps out the car she gives me a look that she thinks is sexy but is actually terrifying. The second her feet touch the ground, I SLAM the car in reverse and fly out of her driveway as fast as my car can go. You know how most people pull out of a driveway, switch to drive, then drive off ahead? I did not do that. I didn't want that one second of switching gears to give her the chance to catch me. I pulled out the driveway and just kept going down the street in reverse for like 5 blocks. The passenger door was flapping around, still open because I took off before she shut it. When I am satisfied she won't catch me, I close the door, put it in drive, and go home.

Gotta get back on that horse, right? Wrong. I got home, iced my balls and deleted my online dating profile. Not today, Satan.

276 .

>>275
Ça aurait été une grosse érection sans la partie scato.

277 .

Tout d’abord, le Kebab est un plat très calorique qu’il ne convient pas de manger très souvent. En effet, il n’est pas recommandé de manger plus de 2 kebabs par mois.

278 .

http://www.pewsocialtrends.org/interactives/s...

279 .

Hegelian Recognition and Incels
https://www.youtube.com/watch?v=n1flcGrb81M

280 .

>>278
Intéressant mais ne va pas assez loin dans l'interprétation des résultats.

281 .

http://existentialcomics.com/comic/243

282 .

>>281
L'auteur devrait renommer son site « leftistcomics » à force. Et je dis ça alors que je suis pas opposé à ces idées. Depuis qu'il est devenu une star de l'extrême gauche sur twitter il fait de plus en plus de propagande et moins de philosophie.

283 .

Freenodegate refers to a series of ongoing developments regarding the unanticipated connection between the Freenode IRC network and the Pizzagate theory.

284 .

Ce message a été effacé.

285 .

https://news.ycombinator.com/item?id=17663622

286 .

I'm still generally surprised that people, after a long time of reading doujinshi, can't read most general sound effects. Like ごく~ん or ちゅ, or especially ドキドキ or any variation of あ~,あ~ん, or は~. Just take an hour sometime and read some JP doujinshi and you'll be able to read most of the relevant sound effects. I recommend it to any serious masturbator.

287 .

>>286
でも同人誌が日本語で読めるよ!

288 .

>>285
It's shit like this that tells me we deserve another AI Winter. Just at the very least to drive out the dilettantes and charlatans. J'aimerais vraiment que cet anon nous rejoigne. Il possède le ton parfait, entre acrimonie maîtrisée et humour à froid.

289 .

>>288
Peut-être est-il déjà parmi nous.

290 .

>>289
https://www.youtube.com/watch?v=DUFACvZl1cM

291 .

Should a bro die in a weight lifting related accident, a bro will add atleast 100 lbs to the bar before reporting the incident

292 .

des poèmes de Sappho au rap bernois, du modèle choral au paradigme néolibéral

293 .

Semion Mogilevich

294 .

https://twitter.com/CalebJHull/status/1025384...

295 .

I'm replying to you as someone whose children attend coder dojo twice a week, and they both have gtx 1070s despite being 7 and 9 respectively, this is relevant as evidence that I truly believe giving my children the best leg up in our society, requires them to have a a deep understanding of computers from a young age.

296 .

Optimist: The glass is half full
Pessimist: The glass is half empty
Realist: Water levels in the glass are rising at an alarming rate due to human activity, and it's too late to stop it

297 .

https://www.youtube.com/watch?v=gXjCEeWTD0U
Alex Jones avec de la barbe.

298 .

https://www.youtube.com/watch?v=05Hdeyk_bCs&a...

299 .

>>298
Comme quoi regarder le sport et le loto c'est pareil

300 .

Because we modify the environment in a way that can cause cancer in wildlife, humans can be defined as an “oncogenic species”

301 .

>>300
Le cancer correspondant à un processus nihiliste de croissance perpétuelle, ça colle pas mal avec la société occidentale moderne.

302 .

>>298
C'est fascinant.

303 .

https://en.wikipedia.org/wiki/Positive_disintegration

304 .

C’est ainsi que Karine apprendra qu’elle avait une sœur, un bébé que sa mère a tué à la naissance de 180 coups de couteau…

305 .

http://christophe.heintz.free.fr/bgt/Freakono...
Freakonomics, dont il a été fait mention dont l'autre fil.

306 .

>>305
Tu es ma plus belle victoire.

307 .

https://mobile.twitter.com/acidepulsion/statu...

308 .

In geometry, a simplex (plural: simplexes or simplices) is a generalization of the notion of a triangle or tetrahedron to arbitrary dimensions.

309 .

>>306
J'ai rien compris. Pourquoi?

310 .

https://www.youtube.com/watch?v=POCunVwR5YU&a...

311 .

"The Internet has accomplished what even the most fervent consumer advocates usually cannot: it has vastly shrunk the [information] gap between the experts and the public.
The Internet has proven particularly fruitful for situations in which a face-to-face encounter with an expert might actually exacerbate the problem of asymmetrical information—situations in which an expert uses his informational advantage to make us feel stupid or rushed or cheap or ignoble." Freakonomics, p61.

312 .

I wanted to pick a new race for toon. I forget the name there is a very short troll looking race. I worry that people will think I am not as important because I am not as tall as everyone else. I know it sounds silly. Honestly I'm afraid that I will not be considered equal because I am shorter. Is this normal or is this silly

313 .

>>312
Quiconque utilise le mot toon est soit un maître de la ruse, soit quelqu'un qui a besoin d'aide.

314 .

>>313
mtstq je pensais que le message parlait de choisir un avatar dans un jeu avec des "toons" à la Roger Rabbit.

315 .

>>313
Dans cette phrase, un toon est un personnage de jeu vidéo, plus spécialement de MMORPG.

316 .

>>315
Oui, je sais bien, merci. C'est aussi un mot qui fait sourciller tous les joueurs de MMOs anglophones.

317 .

>>316
les joueurs de MMOs Donc les merdeux dont l'avis n'a aucune valeur à l'instar de celui des fachiasses ironiques de /a/.

318 .

Psychological Distress Among Men Experiencing Physical and Emotional Abuse in Heterosexual Dating Relationships
CATHERINE J. SIMONELLI, KATHLEEN M. INGRAM
First Published December 1, 1998 Research Article
https://doi.org/10.1177/088626098013006001
Article information
No Access

Abstract

This study examined men's experiences of both emotional and physical abuse in their heterosexual dating relationships. Seventy male undergraduates responded to questionnaires about their current or most recent relationship. Approximately 90% of the men reported having received at least one form of verbal aggression or other emotional abuse from their partner in the past year, and 40% reported having been the target of at least one act of physical violence from their partner. Men who reported receiving more emotional and physical abuse in their dating relationships also reported greater levels of overall psychological distress and depression. Implications for prevention programs and future research are discussed.

319 .

Physical and Emotional Abuse in Romantic Relationships
Motivation for Perpetration Among College Women
Penny A. Leisring, PhD,
First Published December 21, 2012 Research Article
https://doi.org/10.1177/0886260512468236
Article information
No Access

Abstract

Intimate partner violence is extremely common in college samples. To inform prevention and intervention efforts, understanding the motivation for engaging in partner aggression is critically important. The predominant view in the domestic violence field has been that women’s use of intimate partner violence occurs in the context of self-defense. However, there has been a dearth of solid evidence to support this claim. The present study explored the motivations for the perpetration of minor and severe physical aggression and for three types of emotional abuse (restrictive engulfment, denigration, and dominance/intimidation) among college women. A detailed definition of self-defense was used and motivations for women who were sole perpetrators of physical violence as well as motivations for women who had been aggressed against in their romantic relationships were examined. Anger, retaliation for emotional hurt, to get partner’s attention, jealousy, and stress were all common reasons for perpetrating partner violence among college women. Few women indicated that self-defense was a motive for their abusive behavior. The results suggest that prevention and intervention efforts to reduce partner violence perpetration by women should include anger and stress management.

320 .

>>317
les joueurs de MMOs sont pas pertinents pour discuter de la terminologie de MMO Intérédastant.

321 .

About 30% of women and 7% of men reported pain during vaginal intercourse events, and most of the reports of pain were mild and of short duration. About 72% of women and 15% of men reported pain during anal intercourse events, with more of these events including moderate or severe pain (for the women) and of mixed duration. Large proportions of Americans do not tell their partner when sex hurts.

322 .

>>321
Souvent j'ai mal à la bite quand ça tire fort à la base, j'en suis venu à préférer les câlins et les préliminaires.

323 .

Significantly more homosexual than heterosexual women had been abused by a female with whom they had a committed relationship (z = 4.28, p = .001).

324 .

>>316
Oui, je sais bien, merci. C'est aussi un mot qui fait sourciller tous les joueurs de MMOs anglophones. Pas les joueurs de MMOs anglophones qui l'utilisent, visiblement. Et j'ai jamais vu personne sourciller sur ce mot, même sur un jeu anglophone.

325 .

>>323
Ça parait évident, à moins que j'aie mal compris la phrase.

326 .

http://www.mediafire.com/file/615trxeh8r5egad...
http://dl.free.fr/getfile.pl?file=/Updedh0I

327 .

JohB, Aude et Julien étant des randonneurs fous, nous n'avons pas anticipé les différences de niveau.

328 .

https://www.youtube.com/watch?v=AsxsQkKnmBI

329 .

https://www.spectator.co.uk/2018/08/why-are-m...

330 .

>>329
Un article fort intéressant anon, perso je bouffe de la poudre un peu tous les jours à la place du lait et ça me fait parfois penser à l'espèce de pâté qu'ils bouffent dans matrix. Après pour le million de rosbeafs qui tourneraient aux anabolisants ça me semble un peu exagéré, ou alors ils sont en avance sur la dégen... Tout est également la faute à hollywood et ses acteurs chargés comme des mules, aux grandes marques qui sponsorisent le dopage...j'espère que les gens se réveilleront à terme... En tous c'est intéressant aussi de montrer aussi que toutes ces volontés éthiques et de performance conduisent à une certaine dénaturation.

331 .

En tous cas*

332 .

>>329
Dieu est mort, le péché originel avec lui. On satisfaisait sa soif d'absolu et on comble son angoisse métaphysique comme on peut. Cette mentalité d'esclave me laisse de marbre, pourtant je vois que tout est aménagé pour que je tombe dedans aussi.

333 .

in the Discourse on the Origin of Inequality, Rousseau argues that, with the emergence of a competitive public sphere, the ability to turn inward is increasingly compromised, because competitive relations require intense role-playing, which Rousseau calls an “excessive labor”

334 .

In Kierkegaard's view, “becoming what one is” and evading despair and hollowness is not a matter of solitary introspection, but rather a matter of passionate commitment to a relation to something outside oneself that bestows one's life with meaning.

335 .

EVERY lacy or spandexy panty I've tried has invaded my crack like the Mongols.

336 .

https://www.noname.ca/

337 .

https://medium.com/@mirandayardley/transgende...

338 .

A: i believe certain races of people are inferior & we should segregate them from the rest of us

twitter: we are not the arbiters of what is true and false. we welcome this healthy discussion

B: fuck you, racist

twitter: well, that's a ban

339 .

https://www.reddit.com/r/MensLib/comments/958...

340 .

>>339
Belle satire des ânons minables qui viennent ici déblatérer leurs vies sentimentales de merde.

341 .

>>338
C'est dingue je connais quelqu'un qui applique exactement la même méthode de modération. Et les résultats sont tout aussi terribles.

342 .

http://www.idealmedicalcare.org/female-physic...

343 .

https://www.youtube.com/watch?v=sjloThLv6i4

344 .

>>342
Pêh, ceux d'entre eux qui sont des DO ne sont pas médecins mais ostéopathes. Aux État-Unis ils ont une formation et des compétences équivalentes à celles d'un médecin généraliste (ce qui est très loin d'être le cas en France, le pays où il y a le plus d'ostéos par habitants au monde et où la formation a plus en commun avec celle des marabouts), et en général ils sont un peu plus portés sur les thérapies placebo alternatives. Outre-Atlantique, ce sont les chiropracteurs qui jouent le rôle du thérapeute manuel un peu dangereux auquel les patients font beaucoup trop confiance.

345 .

>>344
Kinésithérapeute détecté

346 .

>>345
On va se pacser avec psycho-kun.

347 .

I think it's more "programmer accent" where speech is more logical/analytical, and the cadence of that is similar to say Chinese accent but it is completely different (in my opinion).

348 .

https://www.youtube.com/watch?v=deg1wmYjwtk&a...

349 .

https://www.youtube.com/watch?v=RSkPhP9FZ98

350 .

https://twitter.com/Jauneetjolie/status/10272...

351 .

https://hugelolcdn.com/i/540211.jpg

352 .

https://www.nytimes.com/2018/08/11/business/t...

353 .

https://www.sutori.com/story/timeline-you-mig...

354 .

Le top de https://chucknorrisfacts.fr/facts/top sans la deuxième partie de la « blague » :
Chuck Norris a déjà compté
Chuck Norris donne fréquemment du sang à la Croix-Rouge.
Chuck Norris ne se mouille pas
Chuck Norris peut gagner une partie de puissance 4
Un jour, Chuck Norris a perdu son alliance.
Chuck Norris ne porte pas de montre.
Chuck Norris peut diviser
Chuck Norris a un jour avalé un paquet entier de somnifères.
Un jour, au restaurant, Chuck Norris a commandé un steak.

355 .

>>354
Nostalgie de l'époque où c'était tout à fait possible de se voir alpaguer en public par quelqu'un qui récite ces blagues. Grincement systématique.

356 .

https://www.youtube.com/watch?v=oUxnOGrwuNI

357 .

>>356
Hahahaha putain bien vu

358 .

https://www.youtube.com/watch?v=kSBGDdLe8kE

359 .

>>358
À 32:40, je ne sais pas si Pivot dit « Non » ou « Bon », mais il a l'air de se demander pourquoi il n'a pas invité Nabokov au lieu d'organiser un débat aussi affligeant.

360 .

Nevertheless, when Colette wished to have her name associated with her work as it became widely known, Willy resisted and "locked her in her room until she produced enough pages to suit him."

361 .

It may be better for the environment to not own stuff, but instead use services.

For example, take a fridge. If I buy a fridge, the company I buy it from has an incentive to make it break in N years, so they can sell me a new one, i.e. "planned obsolescence".

However, if I subscribe to a service to keep my food and beverages at a certain temperature, then the company has the incentive to make the fridge last as long as possible.

EDIT: Besides eliminating planned obsolescence, there are more advantages:

- Increased market transparency. The market is more transparent if I know exactly what a service costs me per month, as opposed to buying a product and not knowing when it will fail. A more transparent market leads to better competition.

- Another advantage is that the whole life-cycle of the product, including recycling it, becomes a natural responsibility of the company.

362 .

Christopher Bollas introduced the concept of antinarcissism to describe a self-limiting kind of narcissist who refuse to develop themselves or use their talents,[1] so as to maintain their exaggerated sense of self-importance in defeat. "This anti-elaborative person 'stews in his own juice' and adamantly refuses to nurture himself".[2] The antinarcissist may preserve a hostile, even sadistic, core behind a self-effacing facade of care and consideration for others.

363 .

>>362
Voilà qui frappe un peu trop près de chez moi.

364 .

As was eventually revealed in the 1990s when the unexpurgated versions of Anaïs Nin's diaries were published, Anaïs Nin claims to have had an incestuous relationship with her own father during her late 20s. It has been claimed that this incestuous relationship was encouraged by one of her therapists, who suggested that in retaliation for her father's abandonment of her during her childhood, Anaïs Nin should seduce her father in adulthood and then abandon him. In theory, this was supposed to leave Anaïs Nin feeling empowered.

365 .

>>364
C'est ni intéressant ni discret, pd. Si tu pouvais nous épargner l'inventaire des liens partagés sur JVC ce serait pas mal.

366 .

Ce message a été effacé.

367 .

>>365
agneugneugneu je connais que JVC donc tout ce que j'aime pas vient de là Puisque ça t'intéresse tant que ça sache que ce que j'ai posté provient d'une séance de navigation où j'ai passé https://en.wikipedia.org/wiki/List_of_LGBT_writers au peigne fin. Content ?

368 .

>>365
Si tu pouvais cesser d'invectiver les gens de pd, ça serait chouette.

369 .

>>365
Comment tu sais que ça vient de JVC sans y aller toi-même ?

370 .

>>369
Pas lui, mais à quel moment il a dit qu’il n’allait pas sur jvc ?

371 .

>>365
Ca me fascine toujours un peu les gens qui ne comprennent pas le principe du Ctrl+V. Quand il s'agit d'InsultÂnon en plus, c'est le pompon.

372 .

>>371
La blague c'est qu'Insult-ânon est devenu un même et que l'intervention de >>365 est en fait un copié/collé.

373 .

>>371
Fascinant qu'un candide pense encore que les fils Ctrl+V sont encore remplis avec d'honnêtes liens collés innocemment.

374 .

>>373
Fascinant d'être fasciné à l'idée que les gens fassent des choses dans le but d'accomplir quelque chose.

375 .

>>374
être fasciné à l'idée que les gens fassent des choses dans le but d'accomplir quelque chose Raté tête d'enclume. Une insinuation de trop.

376 .

>>375
Insulte fascinante.

377 .

Sainte fistule c nan.

378 .

https://www.youtube.com/watch?v=Tc8iu0XFUQc

379 .

Karl Amadeus Hartmann (2 August 1905 – 5 December 1963) was a German composer.[1] Sometimes described as the greatest German symphonist of the 20th century,[2] he is now largely overlooked, particularly in English-speaking countries.

380 .

>>378
Weeberie de très haut niveau, j'approuve.

381 .

>>380
>>378
Rien à faire, je suis hermétique à la culture touhou. Autant les jeux sont de bons shoot'em-ups, autant l'univers autour ne m'évoque pas grand chose.

382 .

>>381
Normal que la """culture""" touhou ne t'évoque pas grand-chose, il n'y a pas grand-chose en premier lieu. Rien ou presque à part une monomanie des petites filles et les conneries habituelles des lolipedos ("non c'est pas une petite fille c'est une déesse millénaire qui contrôle le temps j't'assure"). Mention spéciale dans la paresse créative pour le copié-collé de DIO en petite fille.

383 .

>>382
Alors déjà tu retires ce que tu dis, c'est un démon trois fois millénaire.

384 .

>>382
>>383
Et si vous sur-généralisiez des cas spectaculaires de pédophilie à peine dissimulée à l'ensemble des amateurs de produits culturels japonais ou inspiré de leur style alors qu'il existe des explications alternatives à l'intérêt que ces personnes portent au mignon et aux enfants, comme par exemple supposer qu'il existerait un intérêt chez les hommes même jeunes pour tout ce qui est lié à être parent et au prendre soin d'autrui et que cela s'exprimerait sous cette forme car suffisamment éloignée des formes d'expressions jugées féminines et moins facilement accessibles, et que ramener ça à un intérêt purement sexuel renforce des traits culturels délétères ?

385 .

>>384
Ça fait une phrase vachement longue, si je peux me permettre de commenter juste la syntaxe. Une bonne règle de pouce est de calibrer la phrase écrite sur la longueur d'une phrase orale. Si ça excède de très loin les possibilités offertes par les poumons d'un être humain non-fumeur, il faut raccourcir, le risque c'est de perdre ton lecteur qui n'a qu'une quantité finie de mémoire pour y mettre le sens que tu essaies de transmettre. J'essaie de ne pas paraître condescendant, le conseil n'a pas été réclamé mais bon.
Déjà personne ici n'a généralisé à l'ensemble de la pop culture japonaise. Quant aux explications alternatives, elles ont quand même bon dos, quand on peut voir le déluge de contenu pornographique lolicon ...
Après je ne vais pas dire que c'est le cas de tous les chinoisseurs ni partir dans un délire psychanalytique pour expliquer ça, mais je te trouve vraiment fort charitable sur ce coup-là.
Moi je ne parlais même pas de l'aspect sexualisé, c'est juste que subjectivement j'y vois pas trop d'intérêt passé les jeux vidéos et la musique éventuellement. Il y a pas mal de femmes qui aiment ces esthétiques et je ne suis pas sûr qu'elles soient toutes lolicon, il y en a fatalement mais je pense que ça serait plus cool que tu nous fasses part de ton ressenti subjectif plutôt qu'échafauder des hypothèses invérifiables.

386 .

>>385
il ne connait pas Marcel Proust, James Joyce Joyce et Claude Simon Blagapar, pas lui mais moi je ne vois pas de problème avec la longueur de sa phrase. Il aurait pu placer quelques virgules pour délimiter ses propositions clairement et faire une prosodie un peu plus chouette, mais sa phrase est grammaticalement correcte et compréhensible si as un minimum de concentration. Moi mes phrases orales sont régulièrement beaucoup plus longues que >>384 quand je présente un raisonnement sur des notions complexes à des gens qui ont besoin de clarification sur chaque élément, et je me fais comprendre.

Personnellement j'assimile la culture Touhou à tous les autres innombrables gouffres à temps escapistes qui, collectivement, ont un effet abrutissant à l'échelle d'à peu près tous les individus des deux dernières générations (pas que les précédentes n'aient pas eu leur propre lot, mais il n'y a pas de comparaison raisonnable avec l'ampleur que ces passe-temps, au mieux juste improductifs et au pire franchement asociaux, prennent dans la vie des jeunes d'aujourd'hui). C'est un cluster qui touche aux autres japoniaiseries et les dépasse en potentiel d'aliénation. La plupart des animes véhiculent des idéaux, des comportements et des esthétiques qui m'inquiètent, parce que pour ne pas les trouver infantiles il faut être soi-même déjà bien aliéné, et je dis ça en m'étant bien fendu la poire devant certains animes ; mais le rire s'estompe un peu quand je considère que les vrais fans d'anime les prennent souvent au premier degré.

>>384
Tu sais très bien qu'en vérité, la « passion pour le produit culturel japonais », c'est de l'escapisme pur et simple, avec des relents de sexualité malheureuse. La société japonaise est plus adaptées aux introvertis, c'est vrai, mais les animes, les mangas et les jeux vidéo ont la même fonction de déconnexion avec la réalité là-bas (d'ailleurs les adultes japonais qui les consomment sont mis à la marge comme chez nous, d'où le phénomène hikikomori, que tu connais certainement mieux que moi), et, à l'international, ce que tu appelles à juste titre des produits occultent très largement une activité littéraire, artistique et cinématographique de grande qualité, dans laquelle on sent la marque de l'éthique japonaise sans les gamineries mercantiles.

387 .

>>386
La société japonaise est plus adaptée*
Aussi, il s'agit bien de James Joyce, et pas de son fils secret dont le deuxième prénom est aussi le nom de famille.

388 .

>>386
J'allais écrire une longue réponse argumentée mais ça m'a saoulé, et de toute façon mes idées sur le sujet ne sont pas encore clairement formées. Pour résumer, je pense que « l'escapisme » porte en lui un embryon d'utopie et de volonté révolutionnaire, et que le problème n'est pas tant que son contenu est trop différent du réel mais qu'au contraire on trace une frontière imperméable entre imaginaire et réel et qu'on relègue l'imaginaire au plaisir égoïste. Je vois dans beaucoup de produits culturels japonais la mise en scène de rapports sociaux laissant une plus grande place à l'émotion et à la naïveté — entre autres bien sûr, mais je me demande si le reste c'est pas en fait juste une colle pour relier un monde très idéalisé à une réalité sociale perçue comme nécessairement conduite par des intérêts purement égoïstes et sans direction autre que d'accumuler des plaisirs matériels et centrés sur le corps. D'ailleurs en consultant wikipédia je vois que je ne suis pas le seul à y avoir pensé : sur la page « escapism » il y a des références à Ernst Bloch qui a des idées du même genre http://www.uta.edu/huma/illuminations/kell1.htm D'ailleurs j'ai lu il y a quelques temps des articles sur le phénomène hikikomori qui suggère que c'est une forme de retrait pessimiste d'une société qui n'offre rien d'autre d'intéressant que passer sa vie à travailler pour des choses dépourvues de sens. D'ailleurs il y a un article scientifique cité sur wikipédia qui remarque que « l'escapisme » peut prendre une forme « positive » https://sci-hub.tw/10.1080/01490400.2012.633849 Quoi qu'il en soit, je pense que ça vaut le coup de se pencher sur l'idée que l'imagination en rupture apparent avec le réel recèle un potentiel révolutionnaire ; peut-être que personne ici va voir de quoi je parle, surtout que j'ai pas envie d'argumenter, mais j'avais envie de coucher mes idées sur les écrans.

389 .

https://ethicslab.georgetown.edu/phil553/word...

390 .

SCOOP: SEC ramps up investigation into Tesla privatization plans; sends subpoenas to Tesla regarding privatization plans and Musk's statements involving "funding secured"--sources Subpoenas signal investigation has reached the "formal" stages -- sources more now RIP en petits morceaux.

391 .

Je te remercie d'alimenter la discussion avec des messages développés et sans agression.

La première contradiction à considérer les japoniaiseries (je vais utiliser ce terme pour désigner les mangas, animes, jeux vidéos et tout ce qui s'y rapporte parce qu'on ne peut pas y réduire la culture japonaise, mais c'est faute d'avoir trouvé moins dérogatoire, et je suis conscient qu'il y a toujours des contre-exemples qui se démarquent du peloton, mais avec un minimum d'honnêteté on admettra que mes constats sont applicables au plus gros, et en particulier aux plus populaires) comme des objets révolutionnaires, c'est que, comme on le dit depuis tout à l'heure ce sont par essence des produits, qui ont vocation à être achetés et à faire acheter d'autres produits. On ne peut accorder de valeur artistique qu'à une petite minorité de ces productions, qui ne sont de toute façon pas les plus populaires et ont plutôt la cote dans les milieux artistiques eux-mêmes. Le weeb, à l'instar du geek, est défini en premier lieu par le commercial qui le prend pour cible comme un consommateur, et dans les faits son attitude est bien celle d'un consommateur, qui se rend à des conventions, achète des produits dérivés quand il n'achète pas le produit lui-même...

Ensuite, les relations interpersonnelles telles qu'elles sont décrites par les japoniaiseries sont largement idéalisées autour de fantasmes régressifs de perpétuation à l'âge adulte des rapports en milieu scolaire (c'est d'ailleurs un des poncifs les plus omniprésents dans la japoniaiserie que les personnages sont dans une situation qui reproduit approximativement ou exactement les conditions d'un lycée), et en-dehors du fait que ce soit le reflet d'un manque de maturité du consommateur comme du créateur de japoniaiserie, c'est également un des fantasmes du capitalisme total que d'avoir à disposition des individus lisses, naïfs, qui obéissent à l'émotion primaire qu'on leur demande de ressentir.

Pour en revenir aux hikkikomori, bien sûr que c'est une attitude pessimiste de renoncement, il suffit de lire leurs témoignages pour comprendre qu'ils vivent rarement bien leur situation. Là où je ne suis pas d'accord, c'est avec le fait que la société ne permet pas de trouver un sens. La perte de sens, telle que je la perçois, elle a lieu dans la tête de celui qui, à la fin de sa scolarité secondaire, doit sortir du cocon rassurant qu'ils s'est constitué (en réaction à l'isolement social conditionné par l'atomisation ambiante des individus et pour toutes les raisons qui font qu'il y aura toujours de l'exclusion sociale chez les adolescents) pour assumer les responsabilités et les libertés qui permettent justement de s'épanouir et de donner la saveur à la vie, mais ne trouve pas de réalisation socioprofessionnelle compatible avec les idéaux infantiles, dont il s'est imbibé par le produit culturel, dans une société qui, c'est vrai, réduit le champ des possibles en termes de mode de vie, mais n'anéantit pas non plus complètement la possibilité de s'exprimer, de créer et de sortir du cadre.

Une solution, ce serait d'exposer le jeune exclu social pas à des produits rassurants, mais à des œuvres cathartiques (comme il en déborde du paysage culturel japonais, ce n'est pas bien plus dur à trouver que les animes), qui l'aideraient à la fois à court terme à sortir de l'isolement (parce qu'on brille quand même plus et parmi des gens plus intéressants quand on a lu Mishima que Toriyama), et à long terme à percevoir la nécessité intemporelle et valable dans toutes les sociétés de se réaliser pas malgré mais dans la difficulté de la vie. Le renoncement du hiki procède de son incapacité à accepter que la vraie vie ne peut pas être comme dans les animes, qui est en fait une réaction égoïste et autocentrée : « Le monde ne fonctionne pas comme je l'entends ? J'abandonne. »

TL;PL: la vraie culture c'est mieux, autant pour faire la révolution que pour s'adapter à la société capitaliste.

392 .

>>391
La première contradiction à considérer les japoniaiseries [...] comme des objets révolutionnaires Heureusement que j'ai parler d'aspect ou de potentiel permettant de nourrir une perspective pouvant devenir révolutionnaire, et pas directement d'objets révolutionnaires.

Là où je ne suis pas d'accord, c'est avec le fait que la société ne permet pas de trouver un sens. Je ne conteste pas vraiment qu'elle ne permet pas d'en trouver un, mais plutôt qu'elle incite à en accepter un sans se questionner alors qu'il est en fait très pauvre et mène à l'absence de bonheur voire à la souffrance.

Une chose ce pendant qui me chiffonne dans ce que tu dis c'est qu'il faudrait abandonner les idéaux infantiles (ironiquement c'est très présent dans les produits culturels japonais pour la consommation de masse). Et là je demande : pourquoi ? Alors oui ça inclut l'abandon d'une perspective égocentrée sur le monde, mais ça n'inclut pas que ça. Donc je demande réellement : pourquoi faudrait-il abandonner les autres idéaux considérés comme infantile ? Non pas que je soutienne qu'il ne faille pas les abandonner ou au moins les amender ; ce qui m'intéresse c'est plutôt de se pencher sur une question dont on croit que la solution est évidente et de jouer avec l'idée opposée, de la prendre au sérieux pendant quelques temps, pour voir où ça nous mène et si on peut pas en extraire des choses intéressantes. Par exemple, on pourrait facilement imaginer un adulte très très mature nous expliquer qu'il faut à un moment arrêter d'être curieux de tout, de se poser des questions et se mettre à contribuer à la société sérieusement en étant tout le temps en train de faire quelque chose de clairement productif ; sauf que son attitude va à l'encontre de l'état d'esprit nécessaire par exemple à la recherche scientifique (Bourdieu en parle dans « Le point de vue scolastique », et avant de passer à la critique des erreurs que peut entraîner cette position, remarque que c'est un type de pratique nécessitant de passer du temps à manipuler des choses sans intérêt pratique immédiat, libéré de certaines contraintes qui existent les autres champs). Ou encore le besoin d'attachement, très présent chez les enfants mais qui est supposé être remplacé chez les adultes par une attitude plus distante et construite envers par exemple la patrie, son groupe professionnel, ou encore ses amis ; échouer à faire ce changement est vu comme un manque de maturité, mais vu le nombre de personnes qui n'y arrivent pas ou pas parfaitement (il y a même des ratés chez les adultes très très sérieux) me fait dire que ce modèle répond imparfaitement aux besoins humains. Un idéal infantile il me semble ce serait l'acceptation inconditionnelle par autrui de soi ; ça semble immature, mais devine ce qu'on enseigne aux psychologues cliniciens ? Exactement, établir une relation en commençant par l'acceptation inconditionnelle du patient et de l'existence de ses émotions et pensées (pas les actes ceci dit), ce qui permet d'exprimer des choses que le patient ne pourrait pas autrement exprimer, permet de les traiter plus rationnellement, et de poursuivre le développement psychologique, autrement dit de... mûrir. Pour revenir à la culture, sans doute que la vraie culture c'est mieux, mais pourquoi sous-estimer le reste, cracher sur l'escapisme et lui attribuer les maux d'une société ? Je pense que c'est appliquer bêtement une croyance issue de notre culture — et peut-être que c'est aussi, pour revenir à Bourdieu, une instance de la distinction — alors qu'en faisant ça on passe à côté du potentiel — et comme ce qui m'intéresse est de changer le réel, je m'intéresse beaucoup au potentiel, au moins autant qu'au réel — que recèlent ces productions en apparence creuses.

393 .

http://lolakayacongo.net/tanger-un-homosexuel...

394 .

>>392
Je propose qu'on arrête de polluer le Ctrl+V et qu'on relocalise le débat dans les pensées, si tu veux continuer je regarderai là.

J'ai l'impression qu'on ne part pas avec les mêmes défintions de certains termes, et qu'on est dans un malentendu. Qu'on soit bien d'accord, la maturité n'est pas le fait de se conformer bêtement au rôle stéréotypé que la société donne à celui qui occupe sa place, c'est un ensemble complexe de traits de personnalité (l'adaptabilité, l'écoute, l'empathie, la tolérance à la frustration, la conscience de soi, etc...) qui conduit à des réactions appropriées dans la plupart des situations que produit l'environnement de l'individu.

Eu égard à cette définition, qui est à peu près celle de Weschler, qui fait consensus en psychologie clinique, je ne considère un trait, un comportement ou un idéal comme infantile que s'il ne peut être associé à la maturité. Or la curiosité, la capacité d'exprimer ses émotions ou de former des attachements, par exemple, ce sont des traits qu'un adulte mature conserve, et que Molière ne va pas chercher à t'expier avec sa dérision. L'égocentrisme, la naïveté, l'impatience, la difficulté à persévérer face à une difficulté, par contre, sont normaux chez la plupart des enfants, mais à travers de petites humiliations tout au long de la vie, au fur et à mesure que les neurones de Von Economo se myélinisent et par l'exposition à la culture, les gens bien apprennent à s'en débarrasser.

L'exposition à la culture, disais-je. Ce que j'appelle la vraie culture, c'est celle qui est déjà passée à la postérité, qui a perduré avec le temps, en général du fait de la conjonction de deux facteurs : relever d'une forme d'expression approuvée par l'autorité, et avoir une valeur hors de son époque, généralement parce qu'elle nous expose à certains aspects de la complexité de la condition humaine, et que ses enseignements sont transposables à notre vie. La catharsis, quoi.

Et donc j'en viens au fait que le point central de l'argument sur lequel tu t'es concentré, c'est que s'exposer à du mignon ou du réconfortant, ça catharsis pas. Pour ça, il faut du sale, et nécessairement du bien cornélien. Je m'arrête là, ça va encore partir en Clouscard et je dois dormir.

395 .

meuler un rayon pour qu'il n'abîme pasle fond de jante

396 .

https://www.youtube.com/watch?v=zD9mJoLndNM

397 .

https://www.huffingtonpost.fr/michael-dias/po...
Styles : Acrimonie Nuit